NDE1 (NM_001143979) Human Untagged Clone
CAT#: SC324955
NDE1 (untagged)-Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1
"NM_001143979" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NDE1 |
Synonyms | HOM-TES-87; LIS4; MHAC; NDE; NUDE; NUDE1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001143979, the custom clone sequence may differ by one or more nucleotides
ATGGAGGACTCCGGAAAGACTTTCAGCTCCGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCGATGA CCTACAAACAGAGGGCAGAAAATACGCAAGAGGAACTCCGAGAATTCCAGGAGGGAAGCCGAGAATATGA AGCTGAATTGGAGACGCAGCTGCAACAAATTGAAACCAGGAACAGAGACCTCCTGTCCGAAAATAACCGC CTTCGCATGGAGCTGGAAACCATCAAGGAGAAGTTTGAAGTGCAGCACTCTGAAGGCTACCGGCAGATCT CAGCCTTGGAGGATGACCTCGCGCAGACCAAAGCCATTAAAGACCAATTGCAGAAATACATCAGAGAGCT GGAGCAAGCAAATGACGACCTGGAAAGAGCCAAGCGCGCCACGATCATGTCTCTCGAAGACTTTGAGCAG CGCTTGAATCAGGCCATCGAAAGAAATGCCTTCCTGGAAAGTGAACTTGATGAAAAAGAGAATCTCCTGG AATCTGTTCAGAGACTGAAGGATGAAGCCAGAGATTTGCGGCAGGAACTGGCCGTGCAGCAGAAGCAGGA GAAACCCAGGACCCCCATGCCCAGCTCAGTGGAAGCTGAGAGGACAGACACAGCTGTGCAGGCCACGGGC TCCGTGCCGTCCACGCCCATTGCTCACCGAGGACCCAGCTCAAGTTTAAACACACCTGGGAGCTTCAGAC GTGGCCTGGACGACTCCACCGGGGGGACCCCCCTCACACCTGCGGCCCGGATATCAGCCCTCAACATTGT GGGAGACCTACTGCGGAAAGTCGGGGCACTGGAGTCCAAACTCGCTTCCTGCCGGAACCTCGTGTACGAT CAGTCCCCAAACCGAACAGGTGGCCCAGCCTCTGGGCGGAGCAGCAAGAACAGAGATGGCGGGGAGAGAC GGCCAAGCAGCACCAGCGTGCCTTTGGGTGATAAGGGGTTGGACACGAGTTGCCGCTGGTTGTCCAAATC AACAACCAGGTCGTCCAGCTCCTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143979 |
ORF Size | 1008 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001143979.1, NP_001137451.1 |
RefSeq Size | 3936 |
RefSeq ORF | 1008 |
Locus ID | 54820 |
Gene Summary | This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227919 | NDE1 (Myc-DDK-tagged)-Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1 |
USD 420.00 |
|
RG227919 | NDE1 (GFP-tagged) - Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1 |
USD 460.00 |
|
RC227919L3 | Lenti ORF clone of Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC227919L4 | Lenti ORF clone of Human nudE nuclear distribution gene E homolog 1 (A. nidulans) (NDE1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review