ATP1B4 (NM_001142447) Human Untagged Clone

CAT#: SC324990

ATP1B4 (untagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 1


  "NM_001142447" in other vectors (4)

Reconstitution Protocol

USD 760.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP1B4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATP1B4
Synonyms ATPase, (Na+)/K+ transporting, beta 4 polypeptide; OTTHUMP00000023940; X,K-ATPase beta-m subunit
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001142447, the custom clone sequence may differ by one or more nucleotides
ATGAGAAGGCAACTCCGGTCCAGAAGGGCTCCATCCTTTCCTTACAGTTATCGCTACAGA
CTCGATGATCCGGATGAAGCGAACCAGAACTACTTAGCAGATGAAGAGGAGGAAGCAGAA
GAAGAGGCTCGGGTGACGGTGGTGCCCAAATCGGAGGAGGAGGAAGAAGAGGAGGAGAAA
GAAGAGGAGGAAGAGGAGGAAAAGGAGGAGGAAGAGGGTCAAGGTCAGCCAACAGGCAAT
GCCTGGTGGCAGAAATTGCAGATCATGAGTGAATACCTGTGGGATCCAGAGAGAAGGATG
TTTCTGGCCCGAACAGGTCAGAGTTGGAGCCTGATCTTACTCATTTACTTCTTCTTCTAT
GCCTCCTTGGCTGCTGTGATCACCCTCTGCATGTACACACTATTTCTGACCATCAGTCCC
TATATACCAACCTTCACGGAGCGGGTAAAGCCTCCTGGAGTTATGATCAGACCCTTCGCC
CATAGCCTTAACTTCAACTTCAACGTTTCTGAACCCGACACTTGGCAGCATTATGTGATT
AGCCTAAATGGCTTTCTCCAGGGTTATAATGACAGTCTTCAAGAGGAAATGAATGTAGAT
TGTCCCCCGGGGCAGTACTTCATCCAAGATGGCAATGAGGATGAGGACAAGAAGGCCTGC
CAATTTAAGCGCTCCTTCCTAAAGAACTGCTCTGGTCTGGAGGACCCAACTTTTGGATAC
TCTACTGGACAGCCCTGCATCCTTCTAAAGATGAACCGGATTGTAGGCTTTCGTCCTGAG
CTTGGAGATCCTGTGAAGGTTTCCTGCAAAGTTCAGAGAGGTGATGAAAATGACATCCGA
TCCATCAGTTACTACCCAGAGTCGGCTTCTTTTGACCTCCGCTACTACCCTTACTACGGC
AAACTGACTCACGTTAACTACACATCCCCCTTGGTGGCAATGCACTTTACAGACGTGGTG
AAGAACCAAGCAGTGCCTGTGCAGTGCCAACTGAAGGGCAAAGGCGTCATAAATGATGTC
ATCAATGATCGTTTTGTGGGCAGGGTAATCTTTACCCTGAACATAGAAACT
Restriction Sites Please inquire     
ACCN NM_001142447
ORF Size 4773 bp
Insert Size 4773
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142447.1, NP_001135919.1
RefSeq Size 4773
RefSeq ORF 4773
Locus ID 23439
Protein Families Transmembrane
Protein Pathways Cardiac muscle contraction
Gene Summary This gene has been found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na,K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (A). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.