PPAR delta (PPARD) (NM_177435) Human Untagged Clone
CAT#: SC324997
PPARD (untagged)-Human peroxisome proliferator-activated receptor delta (PPARD), transcript variant 2
"NM_177435" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | PPARD |
| Synonyms | FAAR; NR1C2; NUC1; NUCI; NUCII; PPARB |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_177435, the custom clone sequence may differ by one or more nucleotides
ATGGAGCAGCCACAGGAGGAAGCCCCTGAGGTCCGGGAAGAGGAGGAGAAAGAGGAAGTG GCAGAGGCAGAAGGAGCCCCAGAGCTCAATGGGGGACCACAGCATGCACTTCCTTCCAGC AGCTACACAGACCTCTCCCGGAGCTCCTCGCCACCCTCACTGCTGGACCAACTGCAGATG GGCTGTGACGGGGCCTCATGCGGCAGCCTCAACATGGAGTGCCGGGTGTGCGGGGACAAG GCATCGGGCTTCCACTACGGTGTTCATGCATGTGAGGGGTGCAAGGGCTTCTTCCGTCGT ACGATCCGCATGAAGCTGGAGTACGAGAAGTGTGAGCGCAGCTGCAAGATTCAGAAGAAG AACCGCAACAAGTGCCAGTACTGCCGCTTCCAGAAGTGCCTGGCACTGGGCATGTCACAC AACGCTATCCGTTTTGGTCGGATGCCGGAGGCTGAGAAGAGGAAGCTGGTGGCAGGGCTG ACTGCAAACGAGGGGAGCCAGTACAACCCACAGGTGGCCGACCTGAAGGCCTTCTCCAAG CACATCTACAATGCCTACCTGAAAAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATC CTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGACATCGAGACATTGTGG CAGGCAGAGAAGGGGCTGGTGTGGAAGCAGTTGGTGAATGGCCTGCCTCCCTACAAGGAG ATCAGCGTGCACGTCTTCTACCGCTGCCAGTGCACCACAGTGGAGACCGTGCGGGAGCTC ACTGAGTTCGCCAAGAGCATCCCCAGCTTCAGCAGCCTCTTCCTCAACGACCAGGTTACC CTTCTCAAGTATGGCGTGCACGAGGCCATCTTCGCCATGCTGGCCTCTATCGTCAACAAG GACGGGCTGCTGGTAGCCAACGGCAGTGGCTTTGTCACCCGTGAGTTCCTGCGCAGCCTC CGCAAACCCTTCAGTGATATCATTGAGCCTAAGTTTGAATTTGCTGTCAAGTTCAACGCC CTGGAACTTGATGACAGTGACCTGGCCCTATTCATTGCGGCCATCATTCTGTGTGGAGGT GAG |
| Restriction Sites | Please inquire |
| ACCN | NM_177435 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_177435.2, NP_803184.1 |
| RefSeq Size | 2028 bp |
| RefSeq ORF | 1086 bp |
| Locus ID | 5467 |
| Cytogenetics | 6p21.31 |
| Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
| Protein Pathways | Acute myeloid leukemia, Pathways in cancer, PPAR signaling pathway, Wnt signaling pathway |
| Gene Summary | 'This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. The encoded protein is thought to function as an integrator of transcriptional repression and nuclear receptor signaling. It may inhibit the ligand-induced transcriptional activity of peroxisome proliferator activated receptors alpha and gamma, though evidence for this effect is inconsistent. Expression of this gene in colorectal cancer cells may be variable but is typically relatively low. Knockout studies in mice suggested a role for this protein in myelination of the corpus callosum, lipid metabolism, differentiation, and epidermal cell proliferation. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Aug 2017]' Transcript Variant: This variant (2) uses an alternate exon in the 3' coding region and 3'UTR. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227043 | PPARD (Myc-DDK-tagged)-Human peroxisome proliferator-activated receptor delta (PPARD), transcript variant 2 |
USD 420.00 |
|
| RG227043 | PPARD (GFP-tagged) - Human peroxisome proliferator-activated receptor delta (PPARD), transcript variant 2 |
USD 460.00 |
|
| RC227043L3 | Lenti-ORF clone of PPARD (Myc-DDK-tagged)-Human peroxisome proliferator-activated receptor delta (PPARD), transcript variant 2 |
USD 620.00 |
|
| RC227043L4 | Lenti-ORF clone of PPARD (mGFP-tagged)-Human peroxisome proliferator-activated receptor delta (PPARD), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China