IGFL2 (NM_001135113) Human Untagged Clone

CAT#: SC325478

IGFL2 (untagged)-Human IGF-like family member 2 (IGFL2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IGFL2
• Synonyms: UNQ645; VPRI645
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135113, the custom clone sequence may differ by one or more nucleotides
  ATGGTGCCCAGAATCTTCGCTCCTGCTTATGTGTCAGTCTGTCTCCTCCTCTTGTGTCCA
  AGGGAAGTCATCGCTCCCGCTGGCTCAGAACCATGGCTGTGCCAGCCGGCACCCAGGTGT
  GGAGACAAGATCTACAACCCCTTGGAGCAGTGCTGTTACAATGACGCCATCGTGTCCCTG
  AGCGAGACCCGCCAATGTGGTCCCCCCTGCACCTTCTGGCCCTGCTTTGAGCTCTGCTGT
  CTTGATTCCTTTGGCCTCACAAACGATTTTGTTGTGAAGCTGAAGGTTCAGGGTGTGAAT
  TCCCAGTGCCACTCATCTCCCATCTCCAGTAAATGTGAAAGCAGAAGACGTTTTCCC
  
• Restriction Sites: Please inquire
• ACCN: NM_001135113
• ORF Size: 360 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135113.1, NP_001128585.1
• RefSeq Size: 618
• RefSeq ORF: 360
• Locus ID: 147920
• Protein Families: Secreted Protein
• Gene Summary: IGFL2 belongs to the insulin-like growth factor (IGF; see MIM 147440) family of signaling molecules that play critical roles in cellular energy metabolism and in growth and development, especially prenatal growth (Emtage et al., 2006 [PubMed 16890402]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (b) that has a distinct N-terminus and is shorter than isoform a.