FKBP11 (NM_001143782) Human Untagged Clone

CAT#: SC325515

FKBP11 (untagged)-Human FK506 binding protein 11, 19 kDa (FKBP11), transcript variant 3


  "NM_001143782" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FKBP11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FKBP11
Synonyms FKBP19
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001143782, the custom clone sequence may differ by one or more nucleotides
ATGACCCTGCGCCCCTCACTCCTCCCGCTCCATCTGCTGCTGCTGCTGCTGCTCAGTGCG
GCGGTGTGCCGGGCTGAGGCTGGGCTCGAAACCGAAAGTCCCGTCCGGACCCTCCAAGTG
GAGACCCTGGTGGAGCCCCCAGAACCATGTGCCGAGCCCGCTGCTTTTGGAGACACGCTT
CACATACACTACACGGGAAGCTTGGTAGATGGACGTATTATTGACACCTCCCTGACCAGA
GACCCTCTGGTTATAGAACTTGGCCAAAAGCAGGTGATTCCAGGTCTGGAGCAGAGTCTT
CTCGACATGTGTGTGGGAGAGAAGCGAAGGGCAATCATTCCTTCTCACTTGGCCTATGGA
AAACGGGGATTTCCACCATCTGTCCCAGGGACTAAAGACAACCTGATGAGGCCACCTGGC
ATGACCTCCAGCAGCCAG
Restriction Sites Please inquire     
ACCN NM_001143782
ORF Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001143782.1, NP_001137254.1
RefSeq Size 986
RefSeq ORF 441
Locus ID 51303
Protein Families Druggable Genome, Transmembrane
Gene Summary FKBP11 belongs to the FKBP family of peptidyl-prolyl cis/trans isomerases, which catalyze the folding of proline-containing polypeptides. The peptidyl-prolyl isomerase activity of FKBP proteins is inhibited by the immunosuppressant compounds FK506 and rapamycin (Rulten et al., 2006 [PubMed 16596453]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.