RBP1 (NM_001130993) Human Untagged Clone

CAT#: SC325525

RBP1 (untagged)-Human retinol binding protein 1, cellular (RBP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RBP1
• Synonyms: CRABP-I; CRBP; CRBP1; CRBPI; RBPC
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130993, the custom clone sequence may differ by one or more nucleotides
  ATGGATCCTCCCGCAGGCTTTGTGCGCGCTGGGAATCCAGCTGTCGCCGCCCCGCAGAGC
  CCCCTGTCCCCGGAGGGCGCTCATTTCCGGGCCGCCCACCACCCGCGTAGCACCGGCAGC
  CGCTGTCCCGGCAGTCTCCAGCCGTCCCGCCCGCTTGTGGCCAACTGGCTCCAGTCACTC
  CCCGAAATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAG
  GAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAG
  CCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTT
  AGGAACTACATCATGGACTTCCAGGTTGGGAAGGAGTTTGAGGAGGATCTGACAGGCATA
  GATGACCGCAAGTGCATGAGTGAAACTGGCTTTTCCTCT
  
• Restriction Sites: Please inquire
• ACCN: NM_001130993
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130993.1, NP_001124465.1
• RefSeq Size: 667 bp
• RefSeq ORF: 462 bp
• Locus ID: 5947
• Cytogenetics: 3q23
• Gene Summary: 'This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
  Transcript Variant: This variant (3) includes an alternate exon, compared to variant 1, that causes a frameshift. The resulting protein (isoform c) has a distinct C-terminus, compared to isoform a.