p53 DINP1 (TP53INP1) (NM_001135733) Human Untagged Clone

CAT#: SC325541

TP53INP1 (untagged)-Human tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant 2


  "NM_001135733" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TP53INP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TP53INP1
Synonyms p53DINP1; SIP; Teap; TP53DINP1; TP53INP1A; TP53INP1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135733, the custom clone sequence may differ by one or more nucleotides


ATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTCA
ATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAAGA
AGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTACCG
GCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATGGAGG
AGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAAACAAG
TCCTATGGAAAACCTTCTCATTGAACATCCCAGCATGTCTGTCTATGCTGTGCATAACTCCTGCCCTGGT
CTCAGTGAGGCCACCCGTGGGACTGATGAATTACATAGCCCAAGTAGTCCCAGGGCCAGGAAAAGCTGCT
TATAA


Restriction Sites SgfI-MluI     
ACCN NM_001135733
ORF Size 495 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135733.1, NP_001129205.1
RefSeq Size 5666
RefSeq ORF 495
Locus ID 94241
Protein Families Druggable Genome

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.