FBXO28 (NM_001136115) Human Untagged Clone

CAT#: SC325563

FBXO28 (untagged)-Human F-box protein 28 (FBXO28), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO28
• Synonyms: CENP-30; Fbx28
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001136115, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGCAGCGGCGGAGGAGCGGATGGCAGAGGAAGGAGGCGGCGGCCAAGGCGACGGC
  GGTTCCTCTTTGGCCTCCGGCTCTACCCAGCGACAGCCTCCACCGCCCGCGCCACAGCAC
  CCGCAGCCGGGGTCCCAGGCGCTCCCAGCCCCCGCGCTGGCTCCGGACCAGCTGCCTCAA
  AACAACACGCTTGTGGCGCTGCCCATCGTAGCCATCGAGAACATCCTCAGCTTTATGTCC
  TACGACGAAATTAGCCAGCTCCGCCTGGTTTGTAAAAGAATGGACTTGGTCTGCCAGAGA
  ATGTTGAATCAGGGATTTCTGAAAGTGGAGAGGTACCATAATCTATGTCAGAAACAAGTT
  AAAGCACAACTCCCAAGGAGAGAGTCAGAAAGGAGAAACCATTCATTAGCTCGTCATGCA
  GACATTCTTGCTGCTGTTGAAACAAGGCTGTCACTATTAAATATGACTTTCATGAAATAT
  GTGGATTCCAATCTCTGTTGCTTCATCCCAGGAAAGTTCCAGGACCGTCTGCAGCCC
  
• Restriction Sites: Please inquire
• ACCN: NM_001136115
• ORF Size: 540 bp
• Insert Size: 5263
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001136115.1, NP_001129587.1
• RefSeq Size: 5263
• RefSeq ORF: 540
• Locus ID: 23219
• Protein Families: Druggable Genome
• Gene Summary: Members of the F-box protein family, such as FBXO28, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.