Methionine Sulfoxide Reductase A (MSRA) (NM_001135671) Human Untagged Clone
CAT#: SC325581
MSRA (untagged)-Human methionine sulfoxide reductase A (MSRA), transcript variant 3
"NM_001135671" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MSRA |
Synonyms | PMSR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001135671, the custom clone sequence may differ by one or more nucleotides
ATGTGTTCAGAACCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGA TGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAGTGTATTC AACTCAAGTTGGTTTTGCAGGAGGCTATACTTCAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACT GGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCT TCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC CATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAGGTTCTT TCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTCTACTATGCGGAAGACT ACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCC AGTGGGTATTAAAAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135671 |
ORF Size | 579 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001135671.2, NP_001129143.1 |
RefSeq Size | 1645 |
RefSeq ORF | 579 |
Locus ID | 4482 |
Gene Summary | This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014] Transcript Variant: This variant (3) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (c) has a shorter and distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227510 | MSRA (Myc-DDK-tagged)-Human methionine sulfoxide reductase A (MSRA), transcript variant 3 |
USD 420.00 |
|
RG227510 | MSRA (GFP-tagged) - Human methionine sulfoxide reductase A (MSRA), transcript variant 3 |
USD 460.00 |
|
RC227510L3 | Lenti ORF clone of Human methionine sulfoxide reductase A (MSRA), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC227510L4 | Lenti ORF clone of Human methionine sulfoxide reductase A (MSRA), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review