Methionine Sulfoxide Reductase A (MSRA) (NM_001135670) Human Untagged Clone

CAT#: SC325587

MSRA (untagged)-Human methionine sulfoxide reductase A (MSRA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MSRA
• Synonyms: PMSR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135670, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTCGGCCACCCGGAGGGCTTGCCAGCTCCTCCTCCTCCACAGCCTCTTTCCCGTCCCGAGGATGG
  GCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAGGAACAGACCCCTGTAGC
  GGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTT
  GAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGC
  TCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTA
  CCGCTCGGCCATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135670
• ORF Size: 419 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135670.2, NP_001129142.1
• RefSeq Size: 667
• RefSeq ORF: 419
• Locus ID: 4482
• Gene Summary: This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.