Methionine Sulfoxide Reductase A (MSRA) (NM_001135670) Human Untagged Clone

CAT#: SC325587

MSRA (untagged)-Human methionine sulfoxide reductase A (MSRA), transcript variant 2


  "NM_001135670" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MSRA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MSRA
Synonyms PMSR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135670, the custom clone sequence may differ by one or more nucleotides


ATGCTCTCGGCCACCCGGAGGGCTTGCCAGCTCCTCCTCCTCCACAGCCTCTTTCCCGTCCCGAGGATGG
GCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAGGAACAGACCCCTGTAGC
GGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTT
GAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGC
TCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTA
CCGCTCGGCCATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCA


Restriction Sites SgfI-MluI     
ACCN NM_001135670
ORF Size 419 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135670.2, NP_001129142.1
RefSeq Size 667
RefSeq ORF 419
Locus ID 4482
Gene Summary This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.