PSMB5 (NM_001144932) Human Untagged Clone

CAT#: SC325599

PSMB5 (untagged)-Human proteasome (prosome, macropain) subunit, beta type, 5 (PSMB5), transcript variant 3


  "NM_001144932" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSMB5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSMB5
Synonyms LMPX; MB1; X
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144932, the custom clone sequence may differ by one or more nucleotides
ATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGGA
CTTGGGGGTCGTGCAGATCTGCTGGATCTAGGTCCAGGGAGTCTCAGTGATGGTCTGAGC
CTGGCCGCGCCAGGCTGGGGTGTCCCAGAAGAGCCAGGAATCGAAATGCTTCATGGAACA
ACCACCCTGGCCTTCAAGTTCCGCCATGGAGTCATAGTTGCAGCTGACTCCAGGGCTACA
GCGGGTGCTTACATTGCCTCCCAGACGGTGAAGAAGGTGATAGAGATCAACCCATACCTG
CTAGGCACCATGGCTGGGGGCGCAGCGGATTGCAGCTTCTGGGAACGGCTGTTGGCTCGG
CAATGTCGAATCTATGAGCTTCGAAATAAGGAACGCATCTCTGTAGCAGCTGCCTCCAAA
CTGCTTGCCAACATGGTGTATCAGTACAAAGGCATGGGGCTGTCCATGGGCACCATGATC
TGTGGCTGGGATAAGAGAGGCCCTGTGTCTGAAGTTCTGTGCTTGAAACCTAAGTCATTT
GGAATGTACTTGTTTTGTGGGTGTGCTGAGAGGATCGGCAACATGGCAAGGCCTCTACTA
CGTGGACAG
Restriction Sites Please inquire     
ACCN NM_001144932
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001144932.1, NP_001138404.1
RefSeq Size 1379 bp
RefSeq ORF 612 bp
Locus ID 5693
Cytogenetics 14q11.2
Protein Families Protease
Protein Pathways Proteasome
Gene Summary 'The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]'
Transcript Variant: This variant (3) includes an alternate exon, compared to variant 1, that causes a frameshift. The resulting protein (isoform 3) has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.