DEK (NM_001134709) Human Untagged Clone
CAT#: SC325794
DEK (untagged)-Human DEK oncogene (DEK), transcript variant 2
"NM_001134709" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DEK |
Synonyms | D6S231E |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001134709, the custom clone sequence may differ by one or more nucleotides
ATGTCCGCCTCGGCCCCTGCTGCGGAGGGGGAGGGAACCCCCACCCAGCCCGCGTCCGAGAAAGAACCCG AAATGCCCGGTCCCAGAGAGGAGAGCGAGGAGGAAGAGGACGAGGACGACGAGGAGGAGGAGGAGGAGGA AAAAGGAAAGGGGCAGAAACTTTGTGAAATTGAGAGGATACATTTTTTTCTAAGTAAGAAGAAAACCGAT GAACTTAGAAATCTACACAAACTGCTTTACAACAGGCCAGGCACTGTGTCCTCATTAAAGAAGAATGTGG GTCAGTTCAGTGGCTTTCCATTTGAAAAAGGAAGTGTCCAATATAAAAAGAAGGAAGAAATGTTGAAAAA ATTTAGAAATGCCATGTTAAAGAGCATCTGTGAGGTTCTTGATTTGGAGAGATCAGGTGTAAATAGTGAA CTAGTGAAGAGGATCTTGAATTTCTTAATGCATCCAAAGCCTTCTGGCAAACCATTGCCGAAATCTAAAA AAACTTGTAGCAAAGGCAGTAAAAAGGAACGGAACAGTTCTGGAATGGCAAGGAAGGCTAAGCGAACCAA ATGTCCTGAAATTCTGTCAGATGAATCTAGTAGTGATGAAGATGAAAAGAAAAACAAGGAAGAGTCTTCA GATGATGAAGATAAAGAAAGTGAAGAGGAGCCACCAAAAAAGACAGCCAAAAGAGAAAAACCTAAACAGA AAGCTACTTCTAAAAGTAAAAAATCTGTGAAAAGTGCCAATGTTAAGAAAGCAGATAGCAGCACCACCAA GAAGAATCAAAACAGTTCCAAAAAAGAAAGTGAGTCTGAGGATAGTTCAGATGATGAACCTTTAATTAAA AAGTTGAAGAAACCCCCTACAGATGAAGAGTTAAAGGAAACAATAAAGAAATTACTGGCCAGTGCTAACT TGGAAGAAGTCACAATGAAACAGATTTGCAAAAAGGTCTATGAAAATTATCCTACTTATGATTTAACTGA AAGAAAAGATTTCATAAAAACAACTGTAAAAGAGCTAATTTCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134709 |
ORF Size | 1026 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001134709.1, NP_001128181.1 |
RefSeq Size | 2785 |
RefSeq ORF | 1026 |
Locus ID | 7913 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225506 | DEK (Myc-DDK-tagged)-Human DEK oncogene (DEK), transcript variant 2 |
USD 420.00 |
|
RG225506 | DEK (GFP-tagged) - Human DEK oncogene (DEK), transcript variant 2 |
USD 460.00 |
|
RC225506L1 | Lenti ORF clone of Human DEK oncogene (DEK), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225506L2 | Lenti ORF clone of Human DEK oncogene (DEK), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC225506L3 | Lenti ORF clone of Human DEK oncogene (DEK), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225506L4 | Lenti ORF clone of Human DEK oncogene (DEK), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review