OTUD5 (NM_001136159) Human Untagged Clone
CAT#: SC325804
OTUD5 (untagged)-Human OTU domain containing 5 (OTUD5), transcript variant 4
"NM_001136159" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | OTUD5 |
Synonyms | DUBA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001136159, the custom clone sequence may differ by one or more nucleotides
ATGAAGGAGGATGGCGCCTGTCTCTTCCGGGCTGTAGCTGACCAGGTGTATGGAGACCAGGACATGCATG AGGTTGTGCGAAAGCATTGCATGGACTATCTGATGAAGAATGCCGACTACTTCTCCAACTATGTCACAGA GGACTTTACCACCTACATTAACAGGAAGCGGAAAAACAATTGCCATGGCAACCACATTGAGATGCAGGCC ATGGCAGAGATGTACAACCGTCCTGTGGAGGTGTACCAGTACAGCACAGAACCCATCAACACATTCCATG GGATACATCAAAACGAGGACGAACCCATTCGTGTTAGCTACCATCGGAATATCCACTATAATTCAGTGGT GAATCCTAACAAGGCCACCATTGGTGTGGGGCTGGGCCTGCCATCATTCAAACCAGGGTTTGCAGAGCAG TCTCTGATGAAGAATGCCATAAAAACATCGGAGGAGTCATGGATTGAACAGCAGATGCTAGAAGACAAGA AACGGGCCACAGACTGGGAGGCCACAAATGAAGCCATCGAGGAGCAGGTGGCTCGGGAATCCTACCTGCA GTGGTTGCGGGATCAGGAGAAACAGGCTCGCCAGGTCCGAGGCCCCAGCCAGCCCCGGAAAGCCAGCGCC ACATGCAGTTCGGCCACAGCAGCAGCCTCCAGTGGCCTGGAGGAGTGGACTAGCCGGTCCCCGCGGCAGC GGAGTTCAGCCTCGTCACCTGAGCACCCTGAGCTGCATGCTGAATTGGGCATGAAGCCCCCTTCCCCAGG CACTGTTTTAGCTCTTGCCAAACCTCCTTCGCCCTGTGCGCCAGGTACAAGCAGTCAGTTCTCGGCAGGG GCCGACCGGGCAACTTCCCCCCTTGTGTCCCTCTACCCTGCTTTGGAGTGCCGGGCCCTCATTCAGCAGA TGTCCCCCTCTGCCTTTGGTCTGAATGACTGGGATGATGATGAGATCCTAGCTTCGGTGCTGGCAGTGTC CCAACAGGAATACCTAGACAGTATGAAGAAAAACAAAGTGCACAGAGACCCGCCCCCAGACAAGAGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136159 |
ORF Size | 1050 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001136159.1, NP_001129631.1 |
RefSeq Size | 2426 |
RefSeq ORF | 1050 |
Locus ID | 55593 |
Protein Families | Protease |
Protein Pathways | RIG-I-like receptor signaling pathway |
Gene Summary | This gene encodes a member of the OTU (ovarian tumor) domain-containing cysteine protease superfamily. The OTU domain confers deubiquitinase activity and the encoded protein has been shown to suppress the type I interferon-dependent innate immune response by cleaving the polyubiquitin chain from an essential type I interferon adaptor protein. Cleavage results in disassociation of the adaptor protein from a downstream signaling complex and disruption of the type I interferon signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (4) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting protein (isoform c) has a shorter N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226729 | OTUD5 (Myc-DDK-tagged)-Human OTU domain containing 5 (OTUD5), transcript variant 4 |
USD 420.00 |
|
RG226729 | OTUD5 (GFP-tagged) - Human OTU domain containing 5 (OTUD5), transcript variant 4 |
USD 460.00 |
|
RC226729L3 | Lenti ORF clone of Human OTU domain containing 5 (OTUD5), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC226729L4 | Lenti ORF clone of Human OTU domain containing 5 (OTUD5), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review