OTUD5 (NM_001136159) Human Untagged Clone

CAT#: SC325804

OTUD5 (untagged)-Human OTU domain containing 5 (OTUD5), transcript variant 4


  "NM_001136159" in other vectors (4)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OTUD5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OTUD5
Synonyms DUBA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001136159, the custom clone sequence may differ by one or more nucleotides


ATGAAGGAGGATGGCGCCTGTCTCTTCCGGGCTGTAGCTGACCAGGTGTATGGAGACCAGGACATGCATG
AGGTTGTGCGAAAGCATTGCATGGACTATCTGATGAAGAATGCCGACTACTTCTCCAACTATGTCACAGA
GGACTTTACCACCTACATTAACAGGAAGCGGAAAAACAATTGCCATGGCAACCACATTGAGATGCAGGCC
ATGGCAGAGATGTACAACCGTCCTGTGGAGGTGTACCAGTACAGCACAGAACCCATCAACACATTCCATG
GGATACATCAAAACGAGGACGAACCCATTCGTGTTAGCTACCATCGGAATATCCACTATAATTCAGTGGT
GAATCCTAACAAGGCCACCATTGGTGTGGGGCTGGGCCTGCCATCATTCAAACCAGGGTTTGCAGAGCAG
TCTCTGATGAAGAATGCCATAAAAACATCGGAGGAGTCATGGATTGAACAGCAGATGCTAGAAGACAAGA
AACGGGCCACAGACTGGGAGGCCACAAATGAAGCCATCGAGGAGCAGGTGGCTCGGGAATCCTACCTGCA
GTGGTTGCGGGATCAGGAGAAACAGGCTCGCCAGGTCCGAGGCCCCAGCCAGCCCCGGAAAGCCAGCGCC
ACATGCAGTTCGGCCACAGCAGCAGCCTCCAGTGGCCTGGAGGAGTGGACTAGCCGGTCCCCGCGGCAGC
GGAGTTCAGCCTCGTCACCTGAGCACCCTGAGCTGCATGCTGAATTGGGCATGAAGCCCCCTTCCCCAGG
CACTGTTTTAGCTCTTGCCAAACCTCCTTCGCCCTGTGCGCCAGGTACAAGCAGTCAGTTCTCGGCAGGG
GCCGACCGGGCAACTTCCCCCCTTGTGTCCCTCTACCCTGCTTTGGAGTGCCGGGCCCTCATTCAGCAGA
TGTCCCCCTCTGCCTTTGGTCTGAATGACTGGGATGATGATGAGATCCTAGCTTCGGTGCTGGCAGTGTC
CCAACAGGAATACCTAGACAGTATGAAGAAAAACAAAGTGCACAGAGACCCGCCCCCAGACAAGAGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001136159
ORF Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001136159.1, NP_001129631.1
RefSeq Size 2426
RefSeq ORF 1050
Locus ID 55593
Protein Families Protease
Protein Pathways RIG-I-like receptor signaling pathway
Gene Summary This gene encodes a member of the OTU (ovarian tumor) domain-containing cysteine protease superfamily. The OTU domain confers deubiquitinase activity and the encoded protein has been shown to suppress the type I interferon-dependent innate immune response by cleaving the polyubiquitin chain from an essential type I interferon adaptor protein. Cleavage results in disassociation of the adaptor protein from a downstream signaling complex and disruption of the type I interferon signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (4) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting protein (isoform c) has a shorter N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.