XPD (ERCC2) (NM_001130867) Human Untagged Clone

CAT#: SC325890

ERCC2 (untagged)-Human excision repair cross-complementing rodent repair deficiency, complementation group 2 (ERCC2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ERCC2
• Synonyms: COFS2; EM9; TFIIH; TTD; TTD1; XPD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130867, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGGAGCTCAAACGCACGCTGGACGCCAAGGGTCATGGAGTCCTGGAGATGCCCTCAGGCACCGGGA
  AGACAGTATCCCTGTTGGCCCTGATCATGGCATACCAGAGAGCATATCCGCTGGAGGTGACCAAACTCAT
  CTACTGCTCAAGAACTGTGCCAGAGATTGAGAAGGTGATTGAAGAGCTTCGAAAGTTGCTCAACTTCTAT
  GAGAAGCAGGAGGGCGAGAAGCTGCCGTTTCTGGGACTGGCTCTGAGCTCCCGCAAAAACTTGTGTATTC
  ACCCTGAGGTGACACCCCTGCGCTTTGGGAAGGACGTCGATGGGAAATGCCACAGCCTCACAGCCTCCTA
  TGTGCGGGCGCAGTACCAGCATGACACCAGCCTGCCCCACTGCCGATTCTATGAGGAATTTGATGCCCAT
  GGGCGTGAGGTGCCCCTCCCCGCTGGCATCTACAACCTGGATGACCTGAAGGCCCTGGGGCGGCGCCAGG
  GCTGGTGCCCATACTTCCTTGCTCGATACTCAATCCTGCATGCCAATGTGGTGGTTTATAGCTACCACTA
  CCTCCTGGACCCCAAGATTGCAGACCTGGTGTCCAAGGAACTGGCCCGCAAGGCCGTCGTGGTCTTCGAC
  GAGGCCCACAACATTGACAACGTCTGCATCGACTCCATGAGCGTCAACCTCACCCGCCGGACCCTTGACC
  GGTGCCAGGGCAACCTGGAGACCCTGCAGAAGACGGTGCTCAGGATCAAAGAGACAGACGAGCAGCGCCT
  GCGGGACGAGTACCGGCGTCTGGTGGAGGGGCTGCGGGAGGCCAGCGCCGCCCGGGAGACGGACGCCCAC
  CTGGCCAACCCCGTGCTGCCCGACGAAGTGCTGCAGGAGGCAGTGCCTGGCTCCATCCGCACGGCCGAGC
  ATTTCCTGGGCTTCCTGAGGCGGCTGCTGGAGTACGTGAAGTGGCGGCTGCGTGTGCAGCATGTGGTGCA
  GGAGAGCCCGCCCGCCTTCCTGAGCGGCCTGGCCCAGCGCGTGTGCATCCAGCGCAAGCCCCTCAGATTC
  TGTGCTGAACGCCTCCGGTCCCTGCTGCATACTCTGGAGATCACCGACCTTGCTGACTTCTCCCCGCTCA
  CCCTCCTTGCTAACTTTGCCACCCTTGTCAGCACCTACGCCAAAGGCCAGGCTCAGCACTGTGGAAGCAG
  CAGGAACCAAAAAAGATCTCATCCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001130867
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130867.1, NP_001124339.1
• RefSeq Size: 1753 bp
• RefSeq ORF: 1218 bp
• Locus ID: 2068
• Cytogenetics: 19q13.32
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Nucleotide excision repair
• Gene Summary: 'The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
  Transcript Variant: This variant (2) has an additional segment in the 5' region, which results in a downstream AUG start codon, and lacks multiple 3' exons but has an alternate 3' exon, as compared to variant 1. The resulting isoform (2) has a shorter N-terminus and a distinct and shorter C-terminus, as compared to isoform 1.