Coatomer subunit delta (ARCN1) (NM_001142281) Human Untagged Clone
CAT#: SC325908
ARCN1 (untagged)-Human archain 1 (ARCN1), transcript variant 2
"NM_001142281" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ARCN1 |
Synonyms | COPD; SRMMD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001142281, the custom clone sequence may differ by one or more nucleotides
ATGATCCCTGAATATTGCCGAGCCTTAGAAGAGAATGAAATATCTGAGCACTGTTTTGATTTGATTTTTG CTTTTGATGAAATTGTCGCACTGGGATACCGGGAGAATGTTAACTTGGCACAGATCAGAACCTTCACAGA AATGGATTCTCATGAGGAGAAGGTGTTCAGAGCCGTCAGAGAGACTCAAGAACGTGAAGCTAAGGCTGAG ATGCGTCGTAAAGCAAAGGAATTACAACAGGCCCGAAGAGATGCAGAGAGACAGGGCAAAAAAGCACCAG GATTTGGCGGATTTGGCAGCTCTGCAGTATCTGGAGGCAGCACAGCTGCCATGATCACAGAGACCATCAT TGAAACTGATAAACCAAAAGTGGCACCTGCACCAGCCAGGCCTTCAGGCCCCAGCAAGGCTTTAAAACTT GGAGCCAAAGGAAAGGAAGTAGATAACTTTGTGGACAAATTAAAATCTGAAGGTGAAACCATCATGTCCT CTAGTATGGGCAAGCGTACTTCTGAAGCAACCAAAATGCATGCTCCACCCATTAATATGGAAAGTGTACA TATGAAGATTGAAGAAAAGATAACATTAACCTGTGGACGAGACGGAGGATTACAGAATATGGAGTTGCAT GGCATGATCATGCTTAGGATCTCAGATGACAAGTATGGCCGAATTCGTCTTCATGTGGAAAATGAAGATA AGAAAGGGGTGCAGCTACAGACCCATCCAAATGTGGATAAAAAACTTTTCACTGCAGAGTCTCTAATTGG CCTGAAGAATCCAGAGAAGTCATTTCCAGTCAACAGTGACGTAGGGGTGCTAAAGTGGAGACTACAAACC ACAGAGGAATCTTTTATTCCACTGACAATTAATTGCTGGCCCTCGGAGAGTGGAAATGGCTGTGATGTCA ACATAGAATATGAGCTACAAGAAGATAATTTAGAACTGAATGATGTGGTTATCACCATCCCACTCCCGTC TGGTGTCGGCGCGCCTGTTATCGGTGAGATCGATGGGGAGTATCGACATGACAGTCGACGAAATACCCTG GAGTGGTGCCTGCCTGTGATTGATGCCAAAAATAAGAGTGGCAGCCTGGAGTTTAGCATTGCTGGGCAGC CCAATGACTTCTTCCCTGTTCAAGTTTCCTTTGTCTCCAAGAAAAATTACTGTAACATACAGGTTACCAA AGTGACCCAGGTAGATGGAAACAGCCCCGTCAGGTTTTCCACAGAGACCACTTTCCTAGTGGATAAGTAT GAAATTCTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142281 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142281.1, NP_001135753.1 |
RefSeq Size | 3768 bp |
RefSeq ORF | 1272 bp |
Locus ID | 372 |
Cytogenetics | 11q23.3 |
Gene Summary | 'This gene maps in a region, which include the mixed lineage leukemia and Friend leukemia virus integration 1 genes, where multiple disease-associated chromosome translocations occur. It is an intracellular protein. Archain sequences are well conserved among eukaryotes and this protein may play a fundamental role in eukaryotic cell biology. It has similarities to heat shock proteins and clathrin-associated proteins, and may be involved in vesicle structure or trafficking. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1, and encodes a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227118 | ARCN1 (Myc-DDK-tagged)-Human archain 1 (ARCN1), transcript variant 2 |
USD 420.00 |
|
RG227118 | ARCN1 (GFP-tagged) - Human archain 1 (ARCN1), transcript variant 2 |
USD 460.00 |
|
RC227118L3 | Lenti-ORF clone of ARCN1 (Myc-DDK-tagged)-Human archain 1 (ARCN1), transcript variant 2 |
USD 620.00 |
|
RC227118L4 | Lenti-ORF clone of ARCN1 (mGFP-tagged)-Human archain 1 (ARCN1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review