CHM (NM_001145414) Human Untagged Clone

CAT#: SC326527

CHM (untagged)-Human choroideremia (Rab escort protein 1) (CHM), transcript variant 2, mRNA


  "NM_001145414" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHM
Synonyms DXS540; GGTA; HSD-32; REP-1; TCD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145414, the custom clone sequence may differ by one or more nucleotides


ATGGCGGATACTCTCCCTTCGGAGTTTGATGTGATCGTAATAGGGACGGGTTTGCCTGAATCCATCATTG
CAGCTGCATGTTCAAGAAGTGGCCGGAGAGTTCTGCATGTTGATTCAAGAAGCTACTATGGAGGAAACTG
GGCCAGTTTTAGCTTTTCAGGACTATTGTCCTGGCTAAAGGAATACCAGGAAAACAGTGACATTGTAAGT
GACAGTCCAGTGTGGCAAGACCAGATCCTTGAAAATGAAGAAGCCATTGCTCTTAGCAGGAAGGACAAAA
CTATTCAACATGTGGAAGTATTTTGTTATGCCAGGTCCACGCTGCTTTTATGA


Restriction Sites SgfI-MluI     
ACCN NM_001145414
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145414.3, NP_001138886.1
RefSeq Size 2859 bp
RefSeq ORF 333 bp
Locus ID 1121
Cytogenetics Xq21.2
Protein Families Druggable Genome
Gene Summary 'This gene encodes component A of the RAB geranylgeranyl transferase holoenzyme. In the dimeric holoenzyme, this subunit binds unprenylated Rab GTPases and then presents them to the catalytic Rab GGTase subunit for the geranylgeranyl transfer reaction. Rab GTPases need to be geranylgeranyled on either one or two cysteine residues in their C-terminus to localize to the correct intracellular membrane. Mutations in this gene are a cause of choroideremia; also known as tapetochoroidal dystrophy (TCD). This X-linked disease is characterized by progressive dystrophy of the choroid, retinal pigment epithelium and retina. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]'
Transcript Variant: This variant (2) contains a novel 3' terminal exon and lacks many exons at the 3' end compared to variant 1. The resulting isoform (b) is shorter with a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.