GPSM1 (NM_001145639) Human Untagged Clone

CAT#: SC326531

GPSM1 (untagged)-Human G-protein signaling modulator 1 (AGS3-like, C. elegans) (GPSM1), transcript variant 3, mRNA

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPSM1
• Synonyms: AGS3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145639, the custom clone sequence may differ by one or more nucleotides
  ATGGACGACCAGCGTTGTCCCCTGGACGATGGCCAGGCCGGGGCTGCCGAGGCCACGGCC
  GCCCCCACCCTGGAGGACAGGATCGCCCAGCCCTCGATGACGGCCTCGCCCCAGACCGAG
  GAATTCTTCGACCTCATCGCCAGCTCCCAGAGCCGCCGGCTGGACGACCAGCGGGCCAGC
  GTGGGCAGCCTGCCGGGGCTGCGAATCACCCACAGCAATGCAGGGCACCTCCGAGGCCAC
  GGCGAGCCCCAGGAGCCGGGGGACGACTTCTTCAACATGCTCATCAAGTACCAGTCCTCC
  AGGATCGATGACCAGCGCTGCCCGCCACCTGACGTACTGCCCCGGGGCCCTACCATGCCG
  GACGAGGACTTCTTCAGCCTCATTCAGAGGGTGCAGGCTAAGCGCATGGACGAGCAGCGG
  GTGGACCTCGCCGGGGGCCCGGAGCAGGGGGCAGGCGGCCCGCCCGAGCCCCAGCAGCAG
  TGCCAGCCTGGTGCGAGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001145639
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001145639.1, NP_001139111.1
• RefSeq Size: 2075
• RefSeq ORF: 501
• Locus ID: 26086
• Gene Summary: G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks multiple 5' coding exons, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c, also known as AGS3-SHORT) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode the same isoform (c).