ZNF226 (NM_001146220) Human Untagged Clone

CAT#: SC326670

ZNF226 (untagged)-Human zinc finger protein 226 (ZNF226) transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF226
• Synonyms: Kruppel-associated box protein; zinc finger protein 226
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001146220, the custom clone sequence may differ by one or more nucleotides
  ATGAATATGTTCAAGGAAGCAGTGACCTTCAAGGACGTGGCTGTGGCCTTCACGGAGGAG
  GAATTGGGGCTGCTGGGCCCTGCCCAGAGGAAGCTGTACCGAGATGTGATGGTGGAGAAC
  TTTAGGAACCTGCTGTCAGTGGGGCATCCACCCTTCAAACAAGATGTATCACCTATAGAA
  AGAAATGAGCAGCTTTGGATAATGACGACAGCAACCCGAAGACAGGGAAATTTAGATACC
  TTACTTGTAAAAGCTCTTTTGCTCTATGACCTGGCTCAAACT
  
• Restriction Sites: Please inquire
• ACCN: NM_001146220
• ORF Size: 285 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001146220.2, NP_001139692.1
• RefSeq Size: 895
• RefSeq ORF: 285
• Locus ID: 7769
• Protein Families: Transcription Factors
• Gene Summary: May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (6) differs in the 5' UTR and uses an alternate 3' exon, compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. Variants 3, 4, and 6 all encode isoform b.