REEP1 (NM_001164732) Human Untagged Clone

CAT#: SC326717

REEP1 (untagged)-Human receptor accessory protein 1 (REEP1) nuclear gene encoding mitochondrial protein transcript variant 4


  "NM_001164732" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "REEP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol REEP1
Synonyms C2orf23; HMN5B; SPG31; Yip2a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001164732, the custom clone sequence may differ by one or more nucleotides


ATGGTGTCATGGATCATCTCCAGGCTGGTGGTGCTTATATTTGGCACCCTTTACCCTGCGTATTATTCCT
ACAAGGCTGTGAAATCAAAGGACATTAAGGAATATGTCAAATGGATGATGTACTGGATTATATTTGCACT
TTTCACCACAGCAGAGACATTCACAGACATCTTCCTTTGTTGGGACAGGGTGCCTTATCGGAGAGACTGC
GGAGCTTCAGCATGCAGGACCTCACCACCATCAGGGGAGACGGCGCCCCTGCTCCCTCGGGCCCCCCACC
ACCGGGGTCTGGGCGGGCCAGCGGCAAACACGGCCAGCCTAAGATGTCCAGGAGTGCTTCTGAGAGCGCT
AGCAGCTCAGGCACCGCCTAGAATCCTTCGATCTCGCTTCAGGAAGAAAAGTACCTCATCCTCGGCCACC
GAAACCACGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001164732
ORF Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001164732.1, NP_001158204.1
RefSeq Size 3633
RefSeq ORF 432
Locus ID 65055
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and lacks two alternate exons in the central coding region that causes a frameshift, compared to variant 1. The encoded isoform (4) has distinct N- and C-termini and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.