REEP1 (NM_001164732) Human Untagged Clone

CAT#: SC326717

REEP1 (untagged)-Human receptor accessory protein 1 (REEP1) nuclear gene encoding mitochondrial protein transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: REEP1
• Synonyms: C2orf23; HMN5B; SPG31; Yip2a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001164732, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGTCATGGATCATCTCCAGGCTGGTGGTGCTTATATTTGGCACCCTTTACCCTGCGTATTATTCCT
  ACAAGGCTGTGAAATCAAAGGACATTAAGGAATATGTCAAATGGATGATGTACTGGATTATATTTGCACT
  TTTCACCACAGCAGAGACATTCACAGACATCTTCCTTTGTTGGGACAGGGTGCCTTATCGGAGAGACTGC
  GGAGCTTCAGCATGCAGGACCTCACCACCATCAGGGGAGACGGCGCCCCTGCTCCCTCGGGCCCCCCACC
  ACCGGGGTCTGGGCGGGCCAGCGGCAAACACGGCCAGCCTAAGATGTCCAGGAGTGCTTCTGAGAGCGCT
  AGCAGCTCAGGCACCGCCTAGAATCCTTCGATCTCGCTTCAGGAAGAAAAGTACCTCATCCTCGGCCACC
  GAAACCACGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001164732
• ORF Size: 432 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001164732.1, NP_001158204.1
• RefSeq Size: 3633
• RefSeq ORF: 432
• Locus ID: 65055
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and lacks two alternate exons in the central coding region that causes a frameshift, compared to variant 1. The encoded isoform (4) has distinct N- and C-termini and is shorter than isoform 1.