REEP1 (NM_001164731) Human Untagged Clone
CAT#: SC326749
REEP1 (untagged)-Human receptor accessory protein 1 (REEP1) nuclear gene encoding mitochondrial protein transcript variant 3
"NM_001164731" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | REEP1 |
Synonyms | C2orf23; HMN5B; SPG31; Yip2a |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164731, the custom clone sequence may differ by one or more nucleotides
ATGGATCATCTCCAGGCTGGTGGTGTCAAATGGATGATGTACTGGATTATATTTGCACTT TTCACCACAGCAGAGACATTCACAGACATCTTCCTTTGTTGGTTTCCATTCTATTATGAA CTAAAAATAGCATTTGTAGCCTGGCTGCTGTCTCCCTACACAAAAGGCTCCAGCCTCCTG TACAGGAAGTTTGTACATCCCACGCTATCTTCAAAAGAAAAGGAAATCGATGATTGTCTG GTCCAAGCAAAAGACCGAAGTTACGATGCCCTTGTGCACTTCGGGAAGCGGGGCTTGAAC GTGGCCGCCACAGCGGCTGTGATGGCTGCTTCCAAGGGACAGGGTGCCTTATCGGAGAGA CTGCGGAGCTTCAGCATGCAGGACCTCACCACCATCAGGGGAGACGGCGCCCCTGCTCCC TCGGGCCCCCCACCACCGGGGTCTGGGCGGGCCAGCGGCAAACACGGCCAGCCTAAGATG TCCAGGAGTGCTTCTGAGAGCGCTAGCAGCTCAGGCACCGCC |
Restriction Sites | Please inquire |
ACCN | NM_001164731 |
ORF Size | 525 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001164731.1, NP_001158203.1 |
RefSeq Size | 3795 |
RefSeq ORF | 525 |
Locus ID | 65055 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (3) has a distinct and shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228114 | REEP1 (Myc-DDK-tagged)-Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 420.00 |
|
RG228114 | REEP1 (GFP-tagged) - Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 460.00 |
|
RC228114L3 | Lenti-ORF clone of REEP1 (Myc-DDK-tagged)-Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 620.00 |
|
RC228114L4 | Lenti-ORF clone of REEP1 (mGFP-tagged)-Human receptor accessory protein 1 (REEP1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review