REEP1 (NM_001164730) Human Untagged Clone

CAT#: SC326776

REEP1 (untagged)-Human receptor accessory protein 1 (REEP1) nuclear gene encoding mitochondrial protein transcript variant 1


  "NM_001164730" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "REEP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol REEP1
Synonyms C2orf23; HMN5B; SPG31; Yip2a
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164730, the custom clone sequence may differ by one or more nucleotides
ATGCAGAAAGTGCTGAGCAACGGACAGACTGAAGAGGTTAGGTCTGGATCCAGGCTTATA
TTTGGCACCCTTTACCCTGCGTATTATTCCTACAAGGCTGTGAAATCAAAGGACATTAAG
GAATATGTCAAATGGATGATGTACTGGATTATATTTGCACTTTTCACCACAGCAGAGACA
TTCACAGACATCTTCCTTTGTTGGTTTCCATTCTATTATGAACTAAAAATAGCATTTGTA
GCCTGGCTGCTGTCTCCCTACACAAAAGGCTCCAGCCTCCTGTACAGGAAGTTTGTACAT
CCCACGCTATCTTCAAAAGAAAAGGAAATCGATGATTGTCTGGTCCAAGCAAAAGACCGA
AGTTACGATGCCCTTGTGCACTTCGGGAAGCGGGGCTTGAACGTGGCCGCCACAGCGGCT
GTGATGGCTGCTTCCAAGGGACAGGGTGCCTTATCGGAGAGACTGCGGAGCTTCAGCATG
CAGGACCTCACCACCATCAGGGGAGACGGCGCCCCTGCTCCCTCGGGCCCCCCACCACCG
GGGTCTGGGCGGGCCAGCGGCAAACACGGCCAGCCTAAGATGTCCAGGAGTGCTTCTGAG
AGCGCTAGCAGCTCAGGCACCGCC
Restriction Sites Please inquire     
ACCN NM_001164730
ORF Size 627 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001164730.1, NP_001158202.1
RefSeq Size 3752
RefSeq ORF 627
Locus ID 65055
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.