TRIP13 (NM_001166260) Human Untagged Clone

CAT#: SC326859

TRIP13 (untagged)-Human thyroid hormone receptor interactor 13 (TRIP13) transcript variant 2


  "NM_001166260" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRIP13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRIP13
Synonyms 16E1BP; MVA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166260, the custom clone sequence may differ by one or more nucleotides


ATGGACGAGGCCGTGGGCGACCTGAAGCAGGCGCTTCCCTGTGTGGCCGAGTCGCCAACGGTCCACGTGG
AGGTGCATCAGCGCGGCAGCAGCACTGCAAAGAAAGAAGACATAAACCTGAGTGTTAGAAAGCTACTCAA
CAGACATAATATTGTGTTTGGTGATTACACATGGACTGAGTTTGATGAACCTTTTTTGACCAGAAATGTG
CAGTCTGTGTCTATTATTGACACAGAATTAAAGGTTAAAGACTCACAGCCCATCGATTTGAGTGCATGCA
CTGTTGCACTTCACATTTTCCAGCTGAATGAAGATGGCCCCAGCAGTGAAAATCTGGAGGAAGAGACAGA
AAACATAATTGCAGCAAATCACTGGGTTCTACCTGCAGCTGAATTCCATGGGCTTTGGGACAGCTTGGTA
TACGATGTGGAAGTCAAATCCCATCTCCTCGATTATGTGATGACAACTTTACTGTTTTCAGACAAGAACG
TCAACAGCAACCTCATCACCTGGAACCGGGTGGTGCTGCTCCACGGTCCTCCTGGCACTGGAAAAACATC
CCTGTGTAAAGCGTTAGCCCAGAAATTGACAATTAGACTTTCAAGCAGGTACCGATATGGCCAATTAATT
GAAATAAACAGCCACAGCCTCTTTTCTAAGTGGTTTTCGGAAAGTGGCAAGCTGGTAACCAAGATGTTTC
AGAAGATTCAGGATTTGATTGATGATAAAGACGCCCTGGTGTTCGTGCTGATTGATGAGGTGGAGAGTCT
CACAGCCGCCCGAAATGCCTGCAGGGCGGGCACCGAGCCATCAGATGCCATCCGCGTGGTCAATGCTGTC
TTGACCCAAATTGATCAGATTAAAAGGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001166260
ORF Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166260.1, NP_001159732.1
RefSeq Size 1482
RefSeq ORF 870
Locus ID 9319
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Gene Summary This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.