TRIP13 (NM_001166260) Human Untagged Clone
CAT#: SC326859
TRIP13 (untagged)-Human thyroid hormone receptor interactor 13 (TRIP13) transcript variant 2
"NM_001166260" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRIP13 |
Synonyms | 16E1BP; MVA3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001166260, the custom clone sequence may differ by one or more nucleotides
ATGGACGAGGCCGTGGGCGACCTGAAGCAGGCGCTTCCCTGTGTGGCCGAGTCGCCAACGGTCCACGTGG AGGTGCATCAGCGCGGCAGCAGCACTGCAAAGAAAGAAGACATAAACCTGAGTGTTAGAAAGCTACTCAA CAGACATAATATTGTGTTTGGTGATTACACATGGACTGAGTTTGATGAACCTTTTTTGACCAGAAATGTG CAGTCTGTGTCTATTATTGACACAGAATTAAAGGTTAAAGACTCACAGCCCATCGATTTGAGTGCATGCA CTGTTGCACTTCACATTTTCCAGCTGAATGAAGATGGCCCCAGCAGTGAAAATCTGGAGGAAGAGACAGA AAACATAATTGCAGCAAATCACTGGGTTCTACCTGCAGCTGAATTCCATGGGCTTTGGGACAGCTTGGTA TACGATGTGGAAGTCAAATCCCATCTCCTCGATTATGTGATGACAACTTTACTGTTTTCAGACAAGAACG TCAACAGCAACCTCATCACCTGGAACCGGGTGGTGCTGCTCCACGGTCCTCCTGGCACTGGAAAAACATC CCTGTGTAAAGCGTTAGCCCAGAAATTGACAATTAGACTTTCAAGCAGGTACCGATATGGCCAATTAATT GAAATAAACAGCCACAGCCTCTTTTCTAAGTGGTTTTCGGAAAGTGGCAAGCTGGTAACCAAGATGTTTC AGAAGATTCAGGATTTGATTGATGATAAAGACGCCCTGGTGTTCGTGCTGATTGATGAGGTGGAGAGTCT CACAGCCGCCCGAAATGCCTGCAGGGCGGGCACCGAGCCATCAGATGCCATCCGCGTGGTCAATGCTGTC TTGACCCAAATTGATCAGATTAAAAGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166260 |
ORF Size | 870 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166260.1, NP_001159732.1 |
RefSeq Size | 1482 |
RefSeq ORF | 870 |
Locus ID | 9319 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Gene Summary | This gene encodes a protein that interacts with thyroid hormone receptors, also known as hormone-dependent transcription factors. The gene product interacts specifically with the ligand binding domain. This gene is one of several that may play a role in early-stage non-small cell lung cancer. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228224 | TRIP13 (Myc-DDK-tagged)-Human thyroid hormone receptor interactor 13 (TRIP13), transcript variant 2 |
USD 420.00 |
|
RG228224 | TRIP13 (GFP-tagged) - Human thyroid hormone receptor interactor 13 (TRIP13), transcript variant 2 |
USD 460.00 |
|
RC228224L3 | Lenti ORF clone of Human thyroid hormone receptor interactor 13 (TRIP13), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC228224L4 | Lenti ORF clone of Human thyroid hormone receptor interactor 13 (TRIP13), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review