PTGR1 (NM_001146109) Human Untagged Clone

CAT#: SC326870

PTGR1 (untagged)-Human prostaglandin reductase 1 (PTGR1) transcript variant 3


  "NM_001146109" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTGR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTGR1
Synonyms LTB4DH; PGR1; ZADH3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001146109, the custom clone sequence may differ by one or more nucleotides


ATGGTTCGTACTAAGACATGGACCCTGAAGAAGCACTTTGTTGGCTATCCTACTAATAGTGACTTTGAGT
TGAAGACAGCTGAGCTCCCACCCTTAAAAAATGGAGAGGTCCTGCTTGAAGCTTTGTTCCTCACCGTGGA
TCCCTACATGAGAGTGGCAGCCAAAAGATTGAAGGAAGGTGATACAATGATGGGGCAGCAAGTGGCCAAA
GTTGTGGAAAGTAAAAATGTAGCCCTACCAAAAGGAACTATTGTACTGGCTTCTCCAGGCTGGACAACGC
ACTCCATTTCTGATGGGAAAGATCTGGAAAAGCTGCTGACAGAGTGGCCAGACACAATACCACTGTCTTT
GGCTCTGGGGACAGTTGGCATGCCAGGCCTGACTGCCTACTTTGGCCTACTTGAAATCTGTGGTGTGAAG
GGTGGAGAAACAGTGATGGTTAATGCAGCAGCTGGAGCTGTGGGCTCAGTCGTGGGGCAGATTGCAAAGC
TCAAGGGCTGCAAAGTTGTTGGAGCAGTAGGGTCTGATGAAAAGGTTGCCTACCTTCAAAAGCTTGGATT
TGATGTCGTCTTTAACTACAAGACGGTAGAGTCTTTGGAAGAAACCTTGAAGAAAGCGTCTCCTGATGGT
TATGATTGTTATTTTGATAATGTAGGTGGAGAGTTTTCAAACACTGTTATCGGCCAGATGAAGAAATTTG
GAAGGATTGCCATATGTGGAGCCATCTCTACATATAACAGAACCGGCCCACTTCCCCCAGGCCCACCCCC
AGAGATTGTTATCTATCAGGAGCTTCGCATGGAAGCTTTTGTCGTCTACCGCTGGCAAGGAGATGCCCGC
CAAAAAGCTCTGAAGGACTTGCTGAAATGGGTCTTAGAGATCAAAAGAGAAAATGAAGAAGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001146109
ORF Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001146109.1, NP_001139581.1
RefSeq Size 1220
RefSeq ORF 906
Locus ID 22949
Protein Families Druggable Genome
Gene Summary This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.