PTGR1 (NM_001146109) Human Untagged Clone
CAT#: SC326870
PTGR1 (untagged)-Human prostaglandin reductase 1 (PTGR1) transcript variant 3
"NM_001146109" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTGR1 |
Synonyms | LTB4DH; PGR1; ZADH3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001146109, the custom clone sequence may differ by one or more nucleotides
ATGGTTCGTACTAAGACATGGACCCTGAAGAAGCACTTTGTTGGCTATCCTACTAATAGTGACTTTGAGT TGAAGACAGCTGAGCTCCCACCCTTAAAAAATGGAGAGGTCCTGCTTGAAGCTTTGTTCCTCACCGTGGA TCCCTACATGAGAGTGGCAGCCAAAAGATTGAAGGAAGGTGATACAATGATGGGGCAGCAAGTGGCCAAA GTTGTGGAAAGTAAAAATGTAGCCCTACCAAAAGGAACTATTGTACTGGCTTCTCCAGGCTGGACAACGC ACTCCATTTCTGATGGGAAAGATCTGGAAAAGCTGCTGACAGAGTGGCCAGACACAATACCACTGTCTTT GGCTCTGGGGACAGTTGGCATGCCAGGCCTGACTGCCTACTTTGGCCTACTTGAAATCTGTGGTGTGAAG GGTGGAGAAACAGTGATGGTTAATGCAGCAGCTGGAGCTGTGGGCTCAGTCGTGGGGCAGATTGCAAAGC TCAAGGGCTGCAAAGTTGTTGGAGCAGTAGGGTCTGATGAAAAGGTTGCCTACCTTCAAAAGCTTGGATT TGATGTCGTCTTTAACTACAAGACGGTAGAGTCTTTGGAAGAAACCTTGAAGAAAGCGTCTCCTGATGGT TATGATTGTTATTTTGATAATGTAGGTGGAGAGTTTTCAAACACTGTTATCGGCCAGATGAAGAAATTTG GAAGGATTGCCATATGTGGAGCCATCTCTACATATAACAGAACCGGCCCACTTCCCCCAGGCCCACCCCC AGAGATTGTTATCTATCAGGAGCTTCGCATGGAAGCTTTTGTCGTCTACCGCTGGCAAGGAGATGCCCGC CAAAAAGCTCTGAAGGACTTGCTGAAATGGGTCTTAGAGATCAAAAGAGAAAATGAAGAAGATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146109 |
ORF Size | 906 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001146109.1, NP_001139581.1 |
RefSeq Size | 1220 |
RefSeq ORF | 906 |
Locus ID | 22949 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228235 | PTGR1 (Myc-DDK-tagged)-Human prostaglandin reductase 1 (PTGR1), transcript variant 3 |
USD 420.00 |
|
RG228235 | PTGR1 (GFP-tagged) - Human prostaglandin reductase 1 (PTGR1), transcript variant 3 |
USD 460.00 |
|
RC228235L3 | Lenti-ORF clone of PTGR1 (Myc-DDK-tagged)-Human prostaglandin reductase 1 (PTGR1), transcript variant 3 |
USD 620.00 |
|
RC228235L4 | Lenti-ORF clone of PTGR1 (mGFP-tagged)-Human prostaglandin reductase 1 (PTGR1), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review