Alpha 2 Antiplasmin (SERPINF2) (NM_001165921) Human Untagged Clone
CAT#: SC326977
SERPINF2 (untagged)-Human serpin peptidase inhibitor clade F (alpha-2 antiplasmin pigment epithelium derived factor) member 2 (SERPINF2) transcript variant 3
"NM_001165921" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SERPINF2 |
Synonyms | A2AP; AAP; ALPHA-2-PI; API; PLI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001165921, the custom clone sequence may differ by one or more nucleotides
ATGGCGCTGCTCTGGGGGCTCCTGGTGCTCAGCTGGTCCTGCCTGCAAGGCCCCTGCTCCGTGTTCTCCC CTGTGAGCGCCATGGAGCCCTTGGGCCGGCAGCTAACTAGCGGGCCGAACCAGGAGCAGGTGTCCCCACT TACCCTCCTCAAGTTGGGCAACCAGGTACAACCAGGTGCTCAGAACCACACGTTGCAGAGGCTGCAACAG GTGCTGCACGCAGGCTCAGGGCCCTGCCTCCCCCATCTGCTGAGCCGCCTCTGCCAGGACCTGGGCCCCG GCGCGTTCCGACTGGCTGCCAGGATGTACCTGCAGAAAGGATTTCCCATCAAAGAAGATTTCCTGGAACA ATCCGAACAGCTATTTGGGGCAAAGCCCGTGAGCCTGACGGGAAAGCAGGAAGATGACCTGGCAAACATC AACCAATGGGTGAAGGAGGCCACGGAGGGGAAGATTCAGGAATTCCTCTCTGGGCTGCCGGAAGACACCG TGTTGCTTCTCCTCAACGCCATCCACTTCCAGGGTTTCTGGAGGAACAAGTTTGACCCGAGCCTTACCCA GAGAGACTCCTTCCACCTGGACGAGCAGTTCACGGTGCCCGTGGAAATGATGCAGGCCCGCACGTACCCG CTGCGCTGGTTCTTGCTGGAGCAGCCTGAGATCCAGGTGGCTCATTTCCCCTTTAAGAACAACATGAGCT TTGTGGTCCTTGTACCCACCCACTTTGAATGGAACGTGTCCCAGGTACTGGCCAACCTGAGTTGGGACAC CCTGCACCCACCTCTGGTGTGGGAGAGGCCCACCAAGGTCCGGCTGCCTAAGCTGTATCTGAAACACCAA ATGGACCTGGTGGCCACCCTCAGCCAGCTGGGCCTGCAGGAGTTGTTCCAGGCCCCAGACCTGCGTGGGA TCTCCGAGCAGAGCCTGGTGGTGTCCGGCGTGCAGCATCAGTCCACCCTGGAGCTCAGCGAGGTCGGCGT GGAGGCGGCGGCGGCCACCAGCATTGCCATGTCCCGCATGTCCCTGTCCTCCTTCAGCGTGAACCGCCCC TTCCTCTTCTTCATCTTCGAGGACACCACAGGCCTTCCCCTCTTCGTGGGCAGCGTGAGGAACCCCAACC CCAGTGCACCGCGGGAGCTCAAGGAACAGCAGGATTCCCCGGGCAACAAGGACTTCCTCCAGAGCCTGAA AGGCTTCCCCCGCGGAGACAAGCTTTTCGGCCCTGACTTAAAACTTGTGCCCCCCATGGAGGAGGATTAC CCCCAGTTTGGCAGCCCCAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001165921 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001165921.1, NP_001159393.1 |
RefSeq Size | 2126 bp |
RefSeq ORF | 1284 bp |
Locus ID | 5345 |
Cytogenetics | 17p13.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | 'This gene encodes a member of the serpin family of serine protease inhibitors. The protein is a major inhibitor of plasmin, which degrades fibrin and various other proteins. Consequently, the proper function of this gene has a major role in regulating the blood clotting pathway. Mutations in this gene result in alpha-2-plasmin inhibitor deficiency, which is characterized by severe hemorrhagic diathesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]' Transcript Variant: This variant (3) uses an alternate splice site and lacks an alternate exon in the 5' coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228342 | SERPINF2 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3 |
USD 420.00 |
|
RG228342 | SERPINF2 (GFP-tagged) - Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3 |
USD 460.00 |
|
RC228342L3 | Lenti ORF clone of Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC228342L4 | Lenti ORF clone of Human serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 (SERPINF2), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review