APBB2 (NM_001166051) Human Untagged Clone

CAT#: SC327394

APBB2 (untagged)-Human amyloid beta (A4) precursor protein-binding family B member 2 (APBB2) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APBB2
• Synonyms: FE65L; FE65L1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166051, the custom clone sequence may differ by one or more nucleotides
  ATGGCTGAACGGAAGAATGCCAAAGCGCTGGCCTGCAGCTCCTTACAGGAAAGGGCCAAT
  GTGAACCTCGATGTCCCTTTGCAAGTAGATTTTCCAACACCAAAGACTGAGCTGGTCCAG
  AAGTTCCACGTGCAGTACTTGGGCATGTTACCTGTAGACAAACCAGTCGGAATGGATATT
  TTGAACAGTGCCATAGAAAATCTTATGACCTCATCCAACAAGGAGGACTGGCTGTCAGTG
  AACATGAACGTGGCTGATGCCACTGTGACTGTCATCAGTGAAAAGAATGAAGAGGAAGTC
  TTAGTGGAATGTCGTGTGCGATTCCTGTCCTTCATGGGTGTTGGGAAGGACGTCCACACA
  TTTGCCTTCATCATGGACACGGGGAACCAGCGCTTTGAGTGCCACGTTTTCTGGTGCGAG
  CCTAATGCTGGTAACGTGTCTGAGGCGGTGCAGGCCGCCTGCATGTTACGATATCAGAAG
  TGCTTGGTAGCCAGGCCGCCTTCTCAGAAAGTTCGACCACCTCCACCGCCAGCAGATTCA
  GTAACCAGAAGAGTCACAACCAATGTAAAACGAGGGGTCTTATCCCTCATTGACACTTTG
  AAACAGAAACGCCCTGTCACCGAAATGCCA
  
• Restriction Sites: Please inquire
• ACCN: NM_001166051
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001166051.1, NP_001159523.1
• RefSeq Size: 7022 bp
• RefSeq ORF: 633 bp
• Locus ID: 323
• Cytogenetics: 4p14-p13
• Protein Families: Transcription Factors
• Gene Summary: 'The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]'
  Transcript Variant: This variant (4) differs in the presence and absence of exons in the 5' UTR and 5' coding region, and uses a downstream translational start codon, compared to variant 1. The resulting isoform (d) is significantly shorter at the N-terminus, compared to isoform a. Variants 4, 5, 6 and 7 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.