PTGR1 (NM_001146108) Human Untagged Clone

CAT#: SC327460

PTGR1 (untagged)-Human prostaglandin reductase 1 (PTGR1) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTGR1
• Synonyms: LTB4DH; PGR1; ZADH3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001146108, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTCGTACTAAGACATGGACCCTGAAGAAGCACTTTGTTGGCTATCCTACTAATAGTGACTTTGAGT
  TGAAGACAGCTGAGCTCCCACCCTTAAAAAATGGAGAGGTCCTGCTTGAAGCTTTGTTCCTCACCGTGGA
  TCCCTACATGAGAGTGGCAGCCAAAAGATTGAAGGAAGGTGATACAATGATGGGGCAGCAAGTGGCCAAA
  GTTGTGGAAAGTAAAAATGTAGCCCTACCAAAAGGAACTATTGTACTGGCTTCTCCAGGCTGGACAACGC
  ACTCCATTTCTGATGGGAAAGATCTGGAAAAGCTGCTGACAGAGTGGCCAGACACAATACCACTGTCTTT
  GGCTCTGGGGACAGTTGGCATGCCAGGCCTGACTGCCTACTTTGGCCTACTTGAAATCTGTGGTGTGAAG
  GGTGGAGAAACAGTGATGGTTAATGCAGCAGCTGGAGCTGTGGGCTCAGTCGTGGGGCAGATTGCAAAGC
  TCAAGGGCTGCAAAGTTGTTGGAGCAGTAGGGTCTGATGAAAAGGTTGCCTACCTTCAAAAGCTTGGATT
  TGATGTCGTCTTTAACTACAAGACGGTAGAGTCTTTGGAAGAAACCTTGAAGAAAGCGTCTCCTGATGGT
  TATGATTGTTATTTTGATAATGTAGGTGGAGAGTTTTCAAACACTGTTATCGGCCAGATGAAGAAATTTG
  GAAGGATTGCCATATGTGGAGCCATCTCTACATATAACAGAACCGGCCCACTTCCCCCAGGCCCACCCCC
  AGAGATTGTTATCTATCAGGAGCTTCGCATGGAAGCTTTTGTCGTCTACCGCTGGCAAGGAGATGCCCGC
  CAAAAAGCTCTGAAGGACTTGCTGAAATGGGTCTTAGAGGGTAAAATCCAGTACAAGGAATATATCATTG
  AAGGATTTGAAAACATGCCAGCTGCATTTATGGGAATGCTGAAAGGAGATAATTTGGGGAAGACAATAGT
  GAAAGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001146108
• ORF Size: 990 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001146108.1, NP_001139580.1
• RefSeq Size: 1409
• RefSeq ORF: 990
• Locus ID: 22949
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform (1).