GPR17 (NM_001161417) Human Untagged Clone
CAT#: SC327463
GPR17 (untagged)-Human G protein-coupled receptor 17 (GPR17) transcript variant 4
"NM_001161417" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GPR17 |
Synonyms | DKFZp686M18273 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161417, the custom clone sequence may differ by one or more nucleotides
ATGAATGGCCTTGAAGTGGCTCCCCCAGGTCTGATCACCAACTTCTCCCTGGCCACGGCA GAGCAATGTGGCCAGGAGACGCCACTGGAGAACATGCTGTTCGCCTCCTTCTACCTTCTG GATTTTATCCTGGCTTTAGTTGGCAATACCCTGGCTCTGTGGCTTTTCATCCGAGACCAC AAGTCCGGGACCCCGGCCAACGTGTTCCTGATGCATCTGGCCGTGGCCGACTTGTCGTGC GTGCTGGTCCTGCCCACCCGCCTGGTCTACCACTTCTCTGGGAACCACTGGCCATTTGGG GAAATCGCATGCCGTCTCACCGGCTTCCTCTTCTACCTCAACATGTACGCCAGCATCTAC TTCCTCACCTGCATCAGCGCCGACCGTTTCCTGGCCATTGTGCACCCGGTCAAGTCCCTC AAGCTCCGCAGGCCCCTCTACGCACACCTGGCCTGTGCCTTCCTGTGGGTGGTGGTGGCT GTGGCCATGGCCCCGCTGCTGGTGAGCCCACAGACCGTGCAGACCAACCACACGGTGGTC TGCCTGCAGCTGTACCGGGAGAAGGCCTCCCACCATGCCCTGGTGTCCCTGGCAGTGGCC TTCACCTTCCCGTTCATCACCACGGTCACCTGCTACCTGCTGATCATCCGCAGCCTGCGG CAGGGCCTGCGTGTGGAGAAGCGCCTCAAGACCAAGGCAGTGCGCATGATCGCCATAGTG CTGGCCATCTTCCTGGTCTGCTTCGTGCCCTACCACGTCAACCGCTCCGTCTACGTGCTG CACTACCGCAGCCATGGGGCCTCCTGCGCCACCCAGCGCATCCTGGCCCTGGCAAACCGC ATCACCTCCTGCCTCACCAGCCTCAACGGGGCACTCGACCCCATCATGTATTTCTTCGTG GCTGAGAAGTTCCGCCACGCCCTGTGCAACTTGCTCTGTGGCAAAAGGCTCAAGGGCCCG CCCCCCAGCTTCGAAGGGAAAACCAACGAGAGCTCGCTGAGTGCCAAGTCAGAGCTG |
Restriction Sites | Please inquire |
ACCN | NM_001161417 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001161417.1, NP_001154889.1 |
RefSeq Size | 2315 bp |
RefSeq ORF | 1020 bp |
Locus ID | 2840 |
Cytogenetics | 2q14.3 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | '' Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Both variants 3 and 4 encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228828 | GPR17 (Myc-DDK-tagged)-Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
USD 420.00 |
|
RG228828 | GPR17 (GFP-tagged) - Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
USD 460.00 |
|
RC228828L3 | Lenti-ORF clone of GPR17 (Myc-DDK-tagged)-Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
USD 620.00 |
|
RC228828L4 | Lenti-ORF clone of GPR17 (mGFP-tagged)-Human G protein-coupled receptor 17 (GPR17), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review