SLC37A4 (NM_001164280) Human Untagged Clone
CAT#: SC327528
SLC37A4 (untagged)-Human solute carrier family 37 (glucose-6-phosphate transporter) member 4 (SLC37A4) transcript variant 5
"NM_001164280" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC37A4 |
Synonyms | G6PT1; G6PT2; G6PT3; GSD1b; GSD1c; GSD1d; PRO0685; TRG-19; TRG19 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001164280, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCCCAGGGCTATGGCTATTATCGCACTGTGATCTTCTCAGCCATGTTTGGGGGCTACAGCCTGT ATTACTTCAATCGCAAGACCTTCTCCTTTGTCATGCCATCATTGGTGGAAGAGATCCCTTTGGACAAGGA TGATTTGGGGTTCATCACCAGCAGCCAGTCGGCAGCTTATGCTATCAGCAAGTTTGTCAGTGGGGTGCTG TCTGACCAGATGAGTGCTCGCTGGCTCTTCTCTTCTGGGCTGCTCCTGGTTGGCCTGGTCAACATATTCT TTGCCTGGAGCTCCACAGTACCTGTCTTTGCTGCCCTCTGGTTCCTTAATGGCCTGGCCCAGGGGCTGGG CTGGCCCCCATGTGGGAAGGTCCTGCGGAAGTGGTTTGAGCCATCTCAGTTTGGCACTTGGTGGGCCATC CTGTCAACCAGCATGAACCTGGCTGGAGGGCTGGGCCCTATCCTGGCAACCATCCTTGCCCAGAGCTACA GCTGGCGCAGCACGCTGGCCCTATCTGGGGCACTGTGTGTGGTTGTCTCCTTCCTCTGTCTCCTGCTCAT CCACAATGAACCTGCTGATGTTGGACTCCGCAACCTGGACCCCATGCCCTCTGAGGGCAAGAAGGGCTCC TTGAAGGAGGAGAGCACCCTGCAGGAGCTGCTGCTGTCCCCTTACCTGTGGGTGCTCTCCACTGGTTACC TTGTGGTGTTTGGAGTAAAGACCTGCTGTACTGACTGGGGCCAGTTCTTCCTTATCCAGGAGAAAGGACA GTCAGCCCTTGTAGGTAGCTCCTACATGAGTGCCCTGGAAGTTGGGGGCCTTGTAGGCAGCATCGCAGCT GGCTACCTGTCAGACCGGGCCATGGCAAAGGCGGGACTGTCCAACTACGGGAACCCTCGCCATGGCCTGT TGCTGTTCATGATGGCTGGCATGACAGTGTCCATGTACCTCTTCCGGGTAACAGTGACCAGTGACTCCCC CAAGCTCTGGATCCTGGTATTGGGAGCTGTATTTGGTTTCTCCTCGTATGGCCCCATTGCCCTGTTTGGA GTCATAGCCAACGAGAGTGCCCCTCCCAACTTGTGTGGCACCTCCCACGCCATTGTGGGACTCATGGCCA ATGTGGGCGGCTTTCTGGCTGGGCTGCCCTTCAGCACCATTGCCAAGCACTACAGTTGGAGCACAGCCTT CTGGGTGGCTGAAGTGATTTGTGCGGCCAGCACGGCTGCCTTCTTCCTCCTACGAAACATCCGCACCAAG ATGGGCCGAGTGTCCAAGAAGGCTGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001164280 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164280.1, NP_001157752.1 |
RefSeq Size | 2063 bp |
RefSeq ORF | 1290 bp |
Locus ID | 2542 |
Cytogenetics | 11q23.3 |
Protein Families | Transmembrane |
Gene Summary | 'This gene regulates glucose-6-phosphate transport from the cytoplasm to the lumen of the endoplasmic reticulum, in order to maintain glucose homeostasis. It also plays a role in ATP-mediated calcium sequestration in the lumen of the endoplasmic reticulum. Mutations in this gene have been associated with various forms of glycogen storage disease. Alternative splicing in this gene results in multiple transcript variants.[provided by RefSeq, Aug 2009]' Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1, 4, and 5 encode the same protein (isoform 1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228893 | SLC37A4 (Myc-DDK-tagged)-Human solute carrier family 37 (glucose-6-phosphate transporter), member 4 (SLC37A4), transcript variant 5 |
USD 420.00 |
|
RG228893 | SLC37A4 (GFP-tagged) - Human solute carrier family 37 (glucose-6-phosphate transporter), member 4 (SLC37A4), transcript variant 5 |
USD 460.00 |
|
RC228893L3 | Lenti ORF clone of Human solute carrier family 37 (glucose-6-phosphate transporter), member 4 (SLC37A4), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC228893L4 | Lenti ORF clone of Human solute carrier family 37 (glucose-6-phosphate transporter), member 4 (SLC37A4), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review