MGMT (NM_002412) Human Untagged Clone

CAT#: SC327766

MGMT (untagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MGMT
• Synonyms: methylguanine-DNA methyltransferase; O-6-methylguanine-DNA methyltransferase; O6-methylguanine-DNA methyltransferase; OTTHUMP00000020741
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_002412 edited
  ATGCTGGGACAGCCCGCGCCCCTAGAACGCTTTGCGTCCCGACGCCCGCAGGTCCTCGCG
  GTGCGCACCGTTTGCGACTTGGTACTTGGAAAAATGGACAAGGATTGTGAAATGAAACGC
  ACCACACTGGACAGCCCTTTGGGGAAGCTGGAGCTGTCTGGTTGTGAGCAGGGTCTGCAC
  GAAATAAAGCTCCTGGGCAAGGGGACGTCTGCAGCTGATGCCGTGGAGGTCCCAGCCCCC
  GCTGCGGTTCTCGGAGGTCCGGAGCCCCTGATGCAGTGCACAGCCTGGCTGAATGCCTAT
  TTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTC
  CAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGA
  GAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCCGCGCGAGCA
  GTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCATCCCGTGCCACAGAGTGGTC
  TGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGGCCGTGAAGGAATGGCTTCTG
  GCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAGGGAGCTCAGGTCTGGCAGGG
  GCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGAGTA
  TGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTAACACTGCATCGGATGCGGGGC
  GTGGAGGCACCGCTGTATTAAAGGAAGTGGCAGTGTCCTGGGAAAAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_002412
• Insert Size: 1372 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002412.3, NP_002403.2
• RefSeq Size: 1372 bp
• RefSeq ORF: 717 bp
• Locus ID: 4255
• Cytogenetics: 10q26.3
• Domains: Methyltransf_1
• Protein Families: Druggable Genome
• Gene Summary: 'Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015]'