DIO3 (NM_001362) Human Untagged Clone

CAT#: SC327784

DIO3 (untagged)-Human deiodinase iodothyronine type III (DIO3) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Human Untagged Clone
• Symbol: DIO3
• Synonyms: 5DIII; D3; DIOIII; TXDI3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001362, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTCGCCAGGCCACGTCGCGGTTGGTGGTCGGAGAGGGCGAGGGGTCCCAGGGGGCTTCGGGGCCTG
  CAGCCACCATGCTCCGCTCCCTGCTGCTTCACTCCTTGAGGCTCTGCGCCCAGACCGCCTCGTGCCTCGT
  GCTCTTCCCGCGCTTCCTCGGCACGGCCTTCATGCTCTGGCTTCTCGATTTCTTGTGTATCCGCAAGCAT
  TTCCTGGGCCGCCGCCGCCGGGGGCAGCCCGAGCCCGAAGTGGAGCTCAACAGTGAAGGCGAGGAGGTGC
  CTCCCGATGACCCGCCCATCTGCGTGTCCGACGACAACCGCCTGTGCACCCTGGCGTCGCTCAAGGCGGT
  GTGGCATGGCCAGAAGTTGGATTTCTTCAAGCAGGCGCACGAGGGCGGTCCGGCGCCCAACTCCGAGGTG
  GTTCTGCCCGACGGCTTCCAGAGCCAGCACATCCTCGACTACGCGCAAGGGAACCGCCCGCTGGTTCTCA
  ATTTCGGCAGCTGCACCTGACCACCGTTCATGGCGCGCATGAGCGCCTTCCAGCGCCTGGTCACTAAGTA
  CCAGCGCGACGTCGACTTCCTCATCATCTACATCGAGGAAGCGCACCCCTCCGACGGCTGGGTCACCACG
  GACTCTCCCTACATCATCCCACAGCACCGGAGCCTGGAGGACCGGGTCAGCGCAGCGAGGGTACTGCAGC
  AAGGTGCACCCGGCTGCGCTCTGGTCCTCGACACCATGGCCAACTCCAGCAGCTCGGCCTATGGCGCCTA
  CTTCGAGCGTCTCTATGTCATCCAGAGTGGCACTATTATGTACCAGGGCGGCCGTGGCCCCGACGGCTAC
  CAGGTCTCTGAGCTGCGCACTTGGTTGGAACGCTATGATGAGCAACTGCACGGCGCTCGGCCCCGGAGGG
  TGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001362
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001362.3, NP_001353.4
• RefSeq Size: 2120 bp
• Locus ID: 1735
• Cytogenetics: 14q32.31
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this intronless gene belongs to the iodothyronine deiodinase family. It catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3',5-triiodothyronine (T3) to inactive metabolites, 3,3',5'-triiodothyronine (RT3) and 3,3'-diiodothyronine (T2), respectively. This enzyme is highly expressed in pregnant uterus, placenta, fetal and neonatal tissues, and thought to prevent premature exposure of developing fetal tissues to adult levels of thyroid hormones. It regulates circulating fetal thyroid hormone concentrations, and thus plays a critical role in mammalian development. Knockout mice lacking this gene exhibit abnormalities related to development and reproduction, and increased activity of this enzyme in infants with hemangiomas causes severe hypothyroidism. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, May 2016]'