THAP5 (NM_182529) Human Untagged Clone
CAT#: SC327804
THAP5 (untagged)-Human THAP domain containing 5 (THAP5) transcript variant 2
"NM_182529" in other vectors (9)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | THAP5 |
Synonyms | DKFZp313O1132 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_182529, the custom clone sequence may differ by one or more nucleotides
ATGAAGCGAGATTCATGGGTTCCCAGTAAATACCAGTTTCTATGTAGTGACCATTTTACT CCTGACTCTCTTGACATCAGATGGGGTATTCGATATTTAAAACAAACTGCAGTTCCAACA ATATTTTCTTTGCCTGAAGACAATCAGGGAAAAGACCCTTCTAAAAAAAAATCCCAGAAG AAAAACTTGGAAGATGAGAAAGAAGTATGCCCAAAAGCCAAGTCAGAAGAATCATTTGTA TTAAATGAGACAAAGAAAAATATAGTTAACACAGATGTGCCCCATCAACATCCAGAATTA CTTCATTCATCTTCCTTGGTAAAGCCACCAGCTCCCAAAACAGGAAGTATACAAAATAAC ATGTTAACTCTTAATCTAGTTAAACAACATACTGGGAAACCAGAATCTACCTTGGAAACA TCAGTTAACCAAGATACAGGTAGAGGTGGTTTTCACACATGTTTTGAGAATCTAAATTCT ACAACTATTACTTTGACAACTTCAAATTCAGAAAGTATTCATCAATCTTTGGAAACTCAA GAAGTTCTTGAAGTAACTACCAGTCATCTTGCTAATCCAAACTTTACAAGTAATTCCATG GAAATAAAGTCAGCACAGGAAAATCCATTCTTATTCAGCACAATTAATCAAACAGTTGAA GAATTAAACACAAATAAAGAATCTGTTATTGCCATTTTTGTACCTGCTGAAAATTCTAAA CCCTCAGTTAATTCTTTTATATCTGCACAAAAAGAAACCACGGAAATGGAAGACACAGAC ATTGAAGACTCCTTGTATAAGGATGTAGACTATGGGACAGAAGTTTTACAAATCGAACAT TCTTACTGCAGACAAGATATAAATAAGGAACATCTTTGGCAGAAAGTCTCTAAGCTACAT TCAAAGATAACTCTTCTAGAGTTAAAAGAGCAACAAACTCTAGGTAGATTGAAGTCTTTG GAAGCTCTTATAAGGCAGCTAAAGCAGGAAAACTGGCTATCTGAAGAAAACGTCAAGATT ATAGAAAACCATTTTACAACATATGAAGTCACTATGATA |
Restriction Sites | Please inquire |
ACCN | NM_182529 |
ORF Size | 3510 bp |
Insert Size | 3510 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_182529.2, NP_872335.2 |
RefSeq Size | 3510 |
RefSeq ORF | 3510 |
Locus ID | 168451 |
Gene Summary | Has sequence-specific DNA-binding activity and can function as transcriptional repressor (in vitro) (PubMed:21110952). May be a regulator of cell cycle: THAP5 overexpression in human cell lines causes cell cycle arrest at G2/M phase (PubMed:19502560). [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321867 | THAP5 (untagged)-Human THAP domain containing 5 (THAP5), transcript variant 2 |
USD 760.00 |
|
RC208844 | THAP5 (Myc-DDK-tagged)-Human THAP domain containing 5 (THAP5), transcript variant 2 |
USD 420.00 |
|
RC229169 | THAP5 (Myc-DDK-tagged)-Human THAP domain containing 5 (THAP5), transcript variant 2 |
USD 420.00 |
|
RG208844 | THAP5 (GFP-tagged) - Human THAP domain containing 5 (THAP5), transcript variant 2 |
USD 460.00 |
|
RG229169 | THAP5 (GFP-tagged) - Human THAP domain containing 5 (THAP5), transcript variant 2 |
USD 460.00 |
|
RC208844L3 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC208844L4 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC229169L1 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC229169L3 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review