DUSP11 (NM_003584) Human Untagged Clone
CAT#: SC327814
DUSP11 (untagged)-Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11)
"NM_003584" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DUSP11 |
Synonyms | PIR1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_003584, the custom clone sequence may differ by one or more nucleotides
ATGCGCAATAGCGAGACGCTGGAGCGCGGCGTAGGTGGCTGCCGAGTCTTTTCCTGTTTAGGGTCTTATC CTGGCATTGAGGGCGCCGGACTGGCGCTTTTGGCCGACTTGGCATTGGGTGGGCGGCTTCTTGGGACCCA CATGAGCCAGTGGCATCATCCCCGCAGTGGCTGGGGCCGGAGACGCGACTTTTCAGGACGCTCCTCAGCC AAGAAGAAGGGCGGAAACCACATCCCCGAAAGGTGGAAAGACTATCTCCCAGTTGGACAGCGGATGCCTG GGACTCGTTTCATTGCTTTCAAAGTTCCTTTGCAAAAGAGTTTTGAAAAGAAACTTGCTCCAGAAGAATG CTTTTCCCCTTTGGATCTTTTTAACAAAATCCGAGAACAAAATGAAGAACTTGGACTGATTATTGATTTA ACATATACTCAACGCTATTATAAACCAGAGGATTTGCCAGAAACTGTTCCTTACTTAAAAATTTTTACAG TTGGACATCAAGTGCCTGATGATGAGACTATTTTTAAATTCAAACACGCTGTTAATGGGTTTTTGAAAGA AAATAAAGATAATGATAAACTTATTGGTGTCCACTGTACCCATGGTTTAAACAGGACTGGCTACCTCATT TGCAGATATTTGATTGATGTAGAAGGCGTGAGGCCAGATGATGCAATTGAATTATTCAATAGGTGCCGGG GACATTGCTTAGAAAGACAAAACTACATTGAAGACCTTCAGAATGGTCCTATCAGAAAGAATTGGAATTC CAGTGTACCCAGGTCAAGTGATTTTGAAGACTCAGCACATCTCATGCAACCAGTCCACAATAAGCCTGTT AAACAAGGACCTAGGTATAATCTACATCAGATCCAGGGTCACTCAGCTCCTCGACATTTCCACACCCAGA CCCAAAGTTTGCAACAATCAGTCAGAAAATTTTCAGAGAATCCACATGTTTACCAGAGACACCATCTCCC TCCTCCTGGTCCCCCTGGAGAGGACTATTCACACAGGAGGTATTCTTGGAATGTGAAGCCCAATGCCAGT CGGGCAGCCCAGGATAGAAGAAGGTGGTATCCTTATAATTACTCCAGACTCTCCTATCCAGCCTGTTGGG AATGGACCCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_003584 |
ORF Size | 1134 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_003584.2, NP_003575.2 |
RefSeq Size | 1639 |
RefSeq ORF | 1134 |
Locus ID | 8446 |
Domains | DSPc |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. [provided by RefSeq, Sep 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321328 | DUSP11 (untagged)-Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) |
USD 650.00 |
|
RC201822 | DUSP11 (Myc-DDK-tagged)-Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) |
USD 420.00 |
|
RG201822 | DUSP11 (GFP-tagged) - Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) |
USD 460.00 |
|
RC201822L1 | Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), Myc-DDK-tagged |
USD 768.00 |
|
RC201822L2 | Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), mGFP tagged |
USD 620.00 |
|
RC201822L3 | Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), Myc-DDK-tagged |
USD 620.00 |
|
RC201822L4 | Lenti ORF clone of Human dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review