CARD8 (NM_001184904) Human Untagged Clone
CAT#: SC328134
CARD8 (untagged)-Human caspase recruitment domain family member 8 (CARD8) transcript variant 6
"NM_001184904" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CARD8 |
Synonyms | CARDINAL; DACAR; DAKAR; NDPP; NDPP1; TUCAN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001184904, the custom clone sequence may differ by one or more nucleotides
ATGGAAAAAAAGGAGTGTCCAGAAAAGAGTAGCAGCAGTGAGGAAGAGCTGCCGAGACGG GACAGTGGATCCAGTAGGAACATAGATGCATCCAAACTCATTAGACTACAAGGATCACGG AAACTGTTGGTTGACAATAGCATACGGGAACTGCAATACACAAAAACTGGAATTTTTTTT CAGGCTGAGGCCTGTGTGACAAATGATACGTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_001184904 |
ORF Size | 213 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001184904.1, NP_001171833.1 |
RefSeq Size | 634 |
RefSeq ORF | 213 |
Locus ID | 22900 |
Protein Families | Druggable Genome |
Protein Pathways | NOD-like receptor signaling pathway |
Gene Summary | The protein encoded by this gene belongs to the caspase recruitment domain (CARD)-containing family of proteins, which are involved in pathways leading to activation of caspases or nuclear factor kappa-B (NFKB). This protein may be a component of the inflammasome, a protein complex that plays a role in the activation of proinflammatory caspases. It is thought that this protein acts as an adaptor molecule that negatively regulates NFKB activation, CASP1-dependent IL1B secretion, and apoptosis. Polymorphisms in this gene may be associated with a susceptibility to rheumatoid arthritis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010] Transcript Variant: This variant (6) differs in the 5' UTR, 3' coding region, and 3' UTR compared to variant 1. The resulting isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229496 | CARD8 (Myc-DDK-tagged)-Human caspase recruitment domain family, member 8 (CARD8), transcript variant 6 |
USD 420.00 |
|
RG229496 | CARD8 (GFP-tagged) - Human caspase recruitment domain family, member 8 (CARD8), transcript variant 6 |
USD 460.00 |
|
RC229496L3 | Lenti-ORF clone of CARD8 (Myc-DDK-tagged)-Human caspase recruitment domain family, member 8 (CARD8), transcript variant 6 |
USD 620.00 |
|
RC229496L4 | Lenti-ORF clone of CARD8 (mGFP-tagged)-Human caspase recruitment domain family, member 8 (CARD8), transcript variant 6 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review