CARD8 (NM_001184904) Human Untagged Clone

CAT#: SC328134

CARD8 (untagged)-Human caspase recruitment domain family member 8 (CARD8) transcript variant 6


  "NM_001184904" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CARD8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CARD8
Synonyms CARDINAL; DACAR; DAKAR; NDPP; NDPP1; TUCAN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001184904, the custom clone sequence may differ by one or more nucleotides
ATGGAAAAAAAGGAGTGTCCAGAAAAGAGTAGCAGCAGTGAGGAAGAGCTGCCGAGACGG
GACAGTGGATCCAGTAGGAACATAGATGCATCCAAACTCATTAGACTACAAGGATCACGG
AAACTGTTGGTTGACAATAGCATACGGGAACTGCAATACACAAAAACTGGAATTTTTTTT
CAGGCTGAGGCCTGTGTGACAAATGATACGTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites Please inquire     
ACCN NM_001184904
ORF Size 213 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001184904.1, NP_001171833.1
RefSeq Size 634
RefSeq ORF 213
Locus ID 22900
Protein Families Druggable Genome
Protein Pathways NOD-like receptor signaling pathway
Gene Summary The protein encoded by this gene belongs to the caspase recruitment domain (CARD)-containing family of proteins, which are involved in pathways leading to activation of caspases or nuclear factor kappa-B (NFKB). This protein may be a component of the inflammasome, a protein complex that plays a role in the activation of proinflammatory caspases. It is thought that this protein acts as an adaptor molecule that negatively regulates NFKB activation, CASP1-dependent IL1B secretion, and apoptosis. Polymorphisms in this gene may be associated with a susceptibility to rheumatoid arthritis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (6) differs in the 5' UTR, 3' coding region, and 3' UTR compared to variant 1. The resulting isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.