GHRH (NM_001184731) Human Untagged Clone
CAT#: SC328175
GHRH (untagged)-Human growth hormone releasing hormone (GHRH) transcript variant 2
"NM_001184731" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | GHRH |
| Synonyms | GHRF; GRF; INN |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001184731, the custom clone sequence may differ by one or more nucleotides
ATGCCACTCTGGGTGTTCTTCTTTGTGATCCTCACCCTCAGCAACAGCTCCCACTGCTCC CCACCTCCCCCTTTGACCCTCAGGATGCGGCGGTATGCAGATGCCATCTTCACCAACAGC TACCGGAAGGTGCTGGGCCAGCTGTCCGCCCGCAAGCTGCTCCAGGACATCATGAGCAGG CAGCAGGGAGAGAGCAACCAAGAGCGAGGAGCAAGGGCACGGCTTGGTCGTCAGGTAGAC AGCATGTGGGCAGAACAAAAGCAAATGGAATTGGAGAGCATCCTGGTGGCCCTGCTGCAG AAGCACAGGAACTCCCAGGGATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001184731 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001184731.1, NP_001171660.1 |
| RefSeq Size | 459 bp |
| RefSeq ORF | 324 bp |
| Locus ID | 2691 |
| Cytogenetics | 20q11.23 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | 'This gene encodes a member of the glucagon family of proteins. The encoded preproprotein is produced in the hypothalamus and cleaved to generate the mature factor, known as somatoliberin, which acts to stimulate growth hormone release from the pituitary gland. Variant receptors for somatoliberin have been found in several types of tumors, and antagonists of these receptors can inhibit the growth of the tumors. Defects in this gene are a cause of dwarfism, while hypersecretion of the encoded protein is a cause of gigantism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]' Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229537 | GHRH (Myc-DDK-tagged)-Human growth hormone releasing hormone (GHRH), transcript variant 2 |
USD 420.00 |
|
| RG229537 | GHRH (GFP-tagged) - Human growth hormone releasing hormone (GHRH), transcript variant 2 |
USD 460.00 |
|
| RC229537L3 | Lenti-ORF clone of GHRH (Myc-DDK-tagged)-Human growth hormone releasing hormone (GHRH), transcript variant 2 |
USD 620.00 |
|
| RC229537L4 | Lenti-ORF clone of GHRH (mGFP-tagged)-Human growth hormone releasing hormone (GHRH), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China