PAFAH1B2 (NM_001184748) Human Untagged Clone
CAT#: SC328203
PAFAH1B2 (untagged)-Human platelet-activating factor acetylhydrolase 1b catalytic subunit 2 (30kDa) (PAFAH1B2) transcript variant 4
"NM_001184748" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAFAH1B2 |
Synonyms | HEL-S-303 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184748, the custom clone sequence may differ by one or more nucleotides
ATGAGCCAAGGAGACTCAAACCCAGCAGCTATTCCGCATGCAGCAGAAGATATTCAAGGA GATGACCGATGGATGTCTCAGCACAACAGATTTGTTTTGGACTGTAAAGACAAAGAGCCT GATGTACTGTTCGTGGGAGACTCCATGGTGCAGTTAATGCAGCAATATGAGATATGGCGA GAGCTTTTTTCCCCACTTCATGCACTGAATTTTGGAATTGGGGGAGATACAACAAGACAT GTTTTGTGGAGACTAAAGAATGGAGAACTGGAGAATATTAAGCCTAAGGTCATTGTTGTC TGGGTAGGAACAAATAACCACGAAAATACAGCAGAAGAAGTAGCAGGTGGGATCGAGGCC ATTGTACAACTTATCAACACAAGGCAGCCACAGGCGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001184748 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184748.1, NP_001171677.1 |
RefSeq Size | 2537 bp |
RefSeq ORF | 399 bp |
Locus ID | 5049 |
Cytogenetics | 11q23.3 |
Protein Pathways | Ether lipid metabolism, Metabolic pathways |
Gene Summary | 'Platelet-activating factor acetylhydrolase (PAFAH) inactivates platelet-activating factor (PAF) into acetate and LYSO-PAF. This gene encodes the beta subunit of PAFAH, the other subunits are alpha and gamma. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2014]' Transcript Variant: This variant (4) contains a different segment for its 3' end, compared to variant 1. The resulting protein (isoform d) has a shorter and distinct C-terminus when it is compared to isoform a. This variant has also been called SpV-5 in PubMed ID: 18155631. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229565 | PAFAH1B2 (Myc-DDK-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 4 |
USD 420.00 |
|
RG229565 | PAFAH1B2 (GFP-tagged) - Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 4 |
USD 460.00 |
|
RC229565L3 | Lenti-ORF clone of PAFAH1B2 (Myc-DDK-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 4 |
USD 620.00 |
|
RC229565L4 | Lenti-ORF clone of PAFAH1B2 (mGFP-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review