GOLGA7 (NM_001174124) Human Untagged Clone

CAT#: SC328207

GOLGA7 (untagged)-Human golgin A7 (GOLGA7) transcript variant 3


  "NM_001174124" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GOLGA7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GOLGA7
Synonyms GCP16; GOLGA3AP1; GOLGA7A; HSPC041
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001174124, the custom clone sequence may differ by one or more nucleotides


ATGAGGCCGCAGCAGGCGCCGGTGTCCGGAAAGGTGTTCATTCAGCGAGACTACAGCAGTGGCACACGCT
GCCAGTTCCAGACCAAGTTCCCTGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGT
TCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTCGGCGGCCAGTCATATCTCGAAGGTTGTTTG
GCTTGTTTAACAGCATATACCATCTTCCTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCT
CCAAATACATTCAAGAGCAGAATGAGAAGATCTATGCTCCACAAGGCCTCCTCCTGACAGACCCTATTGA
GCGAGGACTGCGAGTTTTTAGATTGAAATTACCATTTATGAAGACAGAGGCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001174124
ORF Size 405 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001174124.1, NP_001167595.1
RefSeq Size 1924
RefSeq ORF 405
Locus ID 51125

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.