Cadherin like 23 (CDH23) (NM_001171936) Human Untagged Clone

CAT#: SC328346

CDH23 (untagged)-Human cadherin-related 23 (CDH23) transcript variant 9


  "NM_001171936" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDH23"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDH23
Synonyms CDHR23; PITA5; USH1D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001171936, the custom clone sequence may differ by one or more nucleotides
ATGCGGTCCTGGTTCCAGCAGGATCCTATGGTGGGAGCATGCACCACAGGCACCAGGGCC
TCACACCCCAAAGCCAACCCTGTGTGGCTGGATCCCTTCTGTCGGAACCTGGAGCTGGCC
GCCCAGGCGGAGCATGAGGATGACCTACCGGAGAACCTGAGTGAGATCGCCGACCTGTGG
AACAGCCCCACGCGCACCCATGGAACTTTTGGGCGTGAGCCAGCAGCTGTCAAGCCTGAT
GATGACCGATACCTGCGGGCTGCCATCCAGGAGTATGACAACATTGCCAAGCTGGGCCAG
ATCATTCGTGAGGGGCCAATCAAGCTGATACAGACTGAGCTGGACGAGGAGCCAGGAGAC
CACAGCCCAGGGCAGGGTAGCCTGCGCTTCCGCCACAAGCCACCAGTGGAGCTCAAGGGG
CCCGATGGGATCCATGTGGTGCACGGCAGCACGGGCACGCTGCTGGCCACCGACCTCAAC
AGCCTGCCCGAGGAAGACCAGAAGGGCCTGGGCCGCTCGCTGGAGACGCTGACCGCTGCC
GAGGCCACTGCCTTCGAGCGCAACGCCCGCACAGAATCCGCCAAATCCACACCCCTGCAC
AAACTTCGCGACGTGATCATGGAGACCCCCCTGGAGATCACAGAGCTGTGA
Restriction Sites Please inquire     
ACCN NM_001171936
ORF Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001171936.1, NP_001165407.1
RefSeq Size 1739
RefSeq ORF 651
Locus ID 64072
Protein Families Transmembrane
Gene Summary This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
Transcript Variant: This variant (9) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks an in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (9, also referred to as isoform C2) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.