PLSCR4 (NM_001177304) Human Untagged Clone

CAT#: SC328356

PLSCR4 (untagged)-Human phospholipid scramblase 4 (PLSCR4) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLSCR4
• Synonyms: TRA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001177304, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAATCAAACAAAACCACCAGATCCAAGGCCTGATGCTCCTCCTGAATACAATTCTCATTTTTTAC
  CAGGACCCCCTGGAACAGCTGTCCCTCCACCTACTGGCTACCCAGGAGGCTTGCCTATGGGATACTACAG
  TCCACAGCAACCCAGTACCTTCCCTTTGTACCAGCCAGTTGGTGGTATCCATCCTGTCCGGTATCAGCCT
  GGCAAATATCCTATGCCAAATCAGTCTGTTCCAATAACATGGATGCCAGGGCCAACTCCTATGGCAAACT
  GCCCTCCTGGTCTGGAATACTTAGTTCAGCTGGAGGTGCAGTGTCCTCCTGGTGTCACCATTGGCTTTGT
  TGCGGAACATTGGAACCTGTGCAGGGCGGTGTACAGCATCCAAAATGAGAAGAAAGAAAATGTGATGAGA
  GTTCGTGGGCCATGCTCAACCTATGGCTGTGGTTCAGATTCTGTTTTTGAGGTCAAATCCCTTGATGGCA
  TATCCAACATCGGCAGTATTATCCGGAAGTGGAATGGTTTGTTATCAGCAATGGCAGATGCTGACCATTT
  TGACATTCACTTCCCACTAGACCTGGATGTGAAGATGAAAGCCATGATTTTTGGAGCTTGCTTCCTCATT
  GACTTCATGTATTTTGAAAGATCTCCACCACAACGTTCAAGATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001177304
• ORF Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001177304.1, NP_001170775.1
• RefSeq Size: 3014
• RefSeq ORF: 675
• Locus ID: 57088
• Gene Summary: May mediate accelerated ATP-independent bidirectional transbilayer migration of phospholipids upon binding calcium ions that results in a loss of phospholipid asymmetry in the plasma membrane. May play a central role in the initiation of fibrin clot formation, in the activation of mast cells and in the recognition of apoptotic and injured cells by the reticuloendothelial system. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, uses a downstream start codon, and lacks two alternate exons resulting in the loss of an in-frame segment in the central coding region, compared to variant 1. The resulting isoform (c) is shorter than isoform a.