FAM120C (NM_198456) Human Untagged Clone

CAT#: SC328382

FAM120C (untagged)-Human family with sequence similarity 120C (FAM120C) transcript variant 2


  "NM_198456" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAM120C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FAM120C
Synonyms CXorf17; ORF34
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_198456, the custom clone sequence may differ by one or more nucleotides
ATGGGTGTCCAGGGCTTCCAAGAGTTCCTGGAGAAGCGCTGTCCCGGGGCCGTGGTGCCC
GTGGACCTCCTAAAACTCGCGCGCACGGTCTCGCGCCAGCAGCAGCAGCAGCACTTGCAC
CGCCAGCTGCCGCCGACTGCAGCCCTAGCGCCCGGGGCTCCACGCGCCGCCAGGGGCTCC
GTGCCTCTGCAACCGCCGCTTCCGCCCGCTGCCTTGGGTGCCTACTCCGGGGGCGCGGGG
CCGATTCGGCACCATCACCCCGCTCACCACTTCCACCATCATGGCCAAGCGCAGCCCGGG
CTGCACCCTCCGCTGCCGCCGCCGCCGCCCCCTCAGCTGCCCGGGGCCCGGGTGCTGGTG
GACGCCGGCTCGGCGCTGCCGCGGCTCTATGGCGGCTACCAGACGGATTGGGTGTGTGGC
GGCCAATGGAACGCCATGCTGGGCTACTTGTCAGCGCTGTGCCAGGCTTGTGCCTATCCT
GGCGGCGACGGCCTGGAGCTCGTGGTCATGTTCCCGGGGGGCCTGGGCAAGGACCGGCTG
GCCGAGTGGGGCCGTCGGTGCCAGGCCGAGCGGCAGACAGCGCAACTGATCGTGGGACAC
GTGGGCAACAAGGGCACCCCTCCACCGCGGGCCTGGTTCCTGCCACCGGCCTGCCTGAGC
CACTGCGTGAGGCTAGCACTCATCCGCTTCCGGGTCAAGCAAGCTGCCATGTTGTGA
Restriction Sites Please inquire     
ACCN NM_198456
ORF Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_198456.1, NP_940858.1
RefSeq Size 1176
RefSeq ORF 717
Locus ID 54954
Gene Summary This gene encodes a potential transmembrane protein and lies in a region where mutations and deletions have been associated with intellectual disability and autism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.