CITED2 (NM_001168388) Human Untagged Clone
CAT#: SC328439
CITED2 (untagged)-Human Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) transcript variant 2
"NM_001168388" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CITED2 |
Synonyms | ASD8; MRG-1; MRG1; P35SRJ; VSD2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001168388, the custom clone sequence may differ by one or more nucleotides
ATGGCAGACCATATGATGGCCATGAACCACGGGCGCTTCCCCGACGGCACCAATGGGCTGCACCATCACC CTGCCCACCGCATGGGCATGGGGCAGTTCCCGAGCCCCCATCACCACCAGCAGCAGCAGCCCCAGCACGC CTTCAACGCCCTAATGGGCGAGCACATACACTACGGCGCGGGCAACATGAATGCCACGAGCGGCATCAGG CATGCGATGGGGCCGGGGACTGTGAACGGAGGGCACCCCCCGAGCGCGCTGGCCCCCGCGGCCAGGTTTA ACAACTCCCAGTTCATGGGTCCCCCGGTGGCCAGCCAGGGAGGCTCCCTGCCGGCCAGCATGCAGCTGCA GAAGCTCAACAACCAGTATTTCAACCATCACCCCTACCCCCACAACCACTACATGCCGGATTTGCACCCT GCTGCAGGCCACCAGATGAACGGGACAAACCAGCACTTCCGAGATTGCAACCCCAAGCACAGCGGCGGCA GCAGCACCCCCGGCGGCTCGGGCGGCAGCAGCACCCCCGGCGGCTCTGGCAGCAGCTCGGGCGGCGGCGC GGGCAGCAGCAACAGCGGCGGCGGCAGCGGCAGCGGCAACATGCCCGCCTCCGTGGCCCACGTCCCCGCT GCAATGCTGCCGCCCAATGTCATAGACACTGATTTCATCGACGAGGAAGTTCTTATGTCCTTGGTGATAG AAATGGGTTTGGACCGCATCAAGGAGCTGCCCGAACTCTGGCTGGGGCAAAACGAGTTTGATTTTATGAC GGACTTCGTGTGCAAACAGCAGCCCAGCAGAGTGAGCTGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168388 |
ORF Size | 813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001168388.2, NP_001161860.1 |
RefSeq Size | 1797 |
RefSeq ORF | 813 |
Locus ID | 10370 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The protein encoded by this gene inhibits transactivation of HIF1A-induced genes by competing with binding of hypoxia-inducible factor 1-alpha to p300-CH1. Mutations in this gene are a cause of cardiac septal defects. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229801 | CITED2 (Myc-DDK-tagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (CITED2), transcript variant 2 |
USD 420.00 |
|
RG229801 | CITED2 (GFP-tagged) - Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (CITED2), transcript variant 2 |
USD 460.00 |
|
RC229801L3 | Lenti ORF clone of Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (CITED2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229801L4 | Lenti ORF clone of Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (CITED2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review