CITED2 (NM_001168389) Human Untagged Clone

CAT#: SC328440

CITED2 (untagged)-Human Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CITED2
• Synonyms: ASD8; MRG-1; MRG1; P35SRJ; VSD2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001168389, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGACCATATGATGGCCATGAACCACGGGCGCTTCCCCGACGGCACCAATGGGCTG
  CACCATCACCCTGCCCACCGCATGGGCATGGGGCAGTTCCCGAGCCCCCATCACCACCAG
  CAGCAGCAGCCCCAGCACGCCTTCAACGCCCTAATGGGCGAGCACATACACTACGGCGCG
  GGCAACATGAATGCCACGAGCGGCATCAGGCATGCGATGGGGCCGGGGACTGTGAACGGA
  GGGCACCCCCCGAGCGCGCTGGCCCCCGCGGCCAGGTTTAACAACTCCCAGTTCATGGGT
  CCCCCGGTGGCCAGCCAGGGAGGCTCCCTGCCGGCCAGCATGCAGCTGCAGAAGCTCAAC
  AACCAGTATTTCAACCATCACCCCTACCCCCACAACCACTACATGCCGGATTTGCACCCT
  GCTGCAGGCCACCAGATGAACGGGACAAACCAGCACTTCCGAGATTGCAACCCCAAGCAC
  AGCGGCGGCAGCAGCACCCCCGGCGGCTCGGGCGGCAGCAGCACCCCCGGCGGCTCTGGC
  AGCAGCTCGGGCGGCGGCGCGGGCAGCAGCAACAGCGGCGGCGGCAGCGGCAGCGGCAAC
  ATGCCCGCCTCCGTGGCCCACGTCCCCGCTGCAATGCTGCCGCCCAATGTCATAGACACT
  GATTTCATCGACGAGGAAGTTCTTATGTCCTTGGTGATAGAAATGGGTTTGGACCGCATC
  AAGGAGCTGCCCGAACTCTGGCTGGGGCAAAACGAGTTTGATTTTATGACGGACTTCGTG
  TGCAAACAGCAGCCCAGCAGAGTGAGCTGTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001168389
• ORF Size: 813 bp
• Insert Size: 1780
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001168389.1, NP_001161861.1
• RefSeq Size: 1780
• RefSeq ORF: 813
• Locus ID: 10370
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: The protein encoded by this gene inhibits transactivation of HIF1A-induced genes by competing with binding of hypoxia-inducible factor 1-alpha to p300-CH1. Mutations in this gene are a cause of cardiac septal defects. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.