CYB5R3 (NM_001171661) Human Untagged Clone

CAT#: SC328454

CYB5R3 (untagged)-Human cytochrome b5 reductase 3 (CYB5R3) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CYB5R3
• Synonyms: B5R; DIA1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171661, the custom clone sequence may differ by one or more nucleotides
  ATGAAGCTGTTCCAGCGCTCCACGCCAGCCATCACCCTCGAGAGCCCGGACATCAAGTAC
  CCGCTGCGGCTCATCGACCGGGAGATCATCAGCCATGACACCCGGCGCTTCCGCTTTGCC
  CTGCCGTCACCCCAGCACATCCTGGGCCTCCCTGTCGGCCAGCACATCTACCTCTCGGCT
  CGAATTGATGGAAACCTGGTCGTCCGGCCCTATACACCCATCTCCAGCGATGATGACAAG
  GGCTTCGTGGACCTGGTCATCAAGGTTTACTTCAAGGACACCCATCCCAAGTTTCCCGCT
  GGAGGGAAGATGTCTCAGTACCTGGAGAGCATGCAGATTGGAGACACCATTGAGTTCCGG
  GGCCCCAGTGGGCTGCTGGTCTACCAGGGCAAAGGGAAGTTCGCCATCCGACCTGACAAA
  AAGTCCAACCCTATCATCAGGACAGTGAAGTCTGTGGGCATGATCGCGGGAGGGACAGGC
  ATCACCCCGATGCTGCAGGTGATCCGCGCCATCATGAAGGACCCTGATGACCACACTGTG
  TGCCACCTGCTCTTTGCCAACCAGACCGAGAAGGACATCCTGCTGCGACCTGAGCTGGAG
  GAACTCAGGAACAAACATTCTGCACGCTTCAAGCTCTGGTACACGCTGGACAGAGCCCCT
  GAAGCCTGGGACTACGGCCAGGGCTTCGTGAATGAGGAGATGATCCGGGACCACCTTCCA
  CCCCCAGAGGAGGAGCCGCTGGTGCTGATGTGTGGCCCCCCACCCATGATCCAGTACGCC
  TGCCTTCCCAACCTGGACCACGTGGGCCACCCCACGGAGCGCTGCTTCGTCTTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001171661
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001171661.1, NP_001165132.1
• RefSeq Size: 2983 bp
• RefSeq ORF: 837 bp
• Locus ID: 1727
• Cytogenetics: 22q13.2
• Protein Families: Druggable Genome
• Protein Pathways: Amino sugar and nucleotide sugar metabolism
• Gene Summary: 'This gene encodes cytochrome b5 reductase, which includes a membrane-bound form in somatic cells (anchored in the endoplasmic reticulum, mitochondrial and other membranes) and a soluble form in erythrocytes. The membrane-bound form exists mainly on the cytoplasmic side of the endoplasmic reticulum and functions in desaturation and elongation of fatty acids, in cholesterol biosynthesis, and in drug metabolism. The erythrocyte form is located in a soluble fraction of circulating erythrocytes and is involved in methemoglobin reduction. The membrane-bound form has both membrane-binding and catalytic domains, while the soluble form has only the catalytic domain. Alternate splicing results in multiple transcript variants. Mutations in this gene cause methemoglobinemias. [provided by RefSeq, Jan 2010]'
  Transcript Variant: This variant (4) uses an alternate exon in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (2) is the soluble form of the enzyme, which has a shorter N-terminus when it is compared to the membrane-bound form. This isoform (2) is referred to in the literature as isoform s. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.