Kir7.1 (KCNJ13) (NM_001172417) Human Untagged Clone

CAT#: SC328458

KCNJ13 (untagged)-Human potassium inwardly-rectifying channel subfamily J member 13 (KCNJ13) transcript variant 3


  "NM_001172417" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNJ13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNJ13
Synonyms KIR1.4; KIR7.1; LCA16; SVD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172417, the custom clone sequence may differ by one or more nucleotides
ATGAATGGTGATCTGGAACTAGATCATGATGCCCCACCTGAAAACCACACTATCTGTGTC
AAGTATATCACCAGTTTCACAGCTGCATTCTCCTTCTCCCTGGAGACACAACTCACAATT
GGTTATGGTACCATGTTCCCCAGTGGTGACTGTCCAAGTGCAATCGCCTTACTTGCCATA
CAAATGCTCCTAGGCCTCATGCTAGAGGCTTTTATCACAGGTGCTTTTGTGGCGAAGATT
GCCCGGCCAAAAAATCGAGCTTTTTCAATTCGCTTTACTGACACAGCAGTAGTAGCTCAC
ATGGATGGCAAACCTAATCTTATCTTCCAAGTGGCCAACACCCGACCTAGCCCTCTAACC
AGTGTCCGGGTCTCAGCTGTACTCTATCAGGAAAGAGAAAATGGCAAACTCTACCAGACC
AGTGTGGATTTCCACCTTGATGGCATCAGTTCTGACGAATGTCCATTCTTCATCTTTCCA
CTAACGTACTATCACTCCATTACACCATCAAGTCCTCTGGCTACTCTGCTCCAGCATGAA
AATCCTTCTCACTTTGAATTAGTTGTATTCCTTTCAGCAATGCAGGAGGGCACTGGAGAA
ATATGCCAAAGGAGGACATCCTACCTACCGTCTGAAATCATGTTACATCACTGTTTTGCA
TCTCTGTTGACCCGAGGTTCCAAAGGTGAATATCAAATCAAGATGGAGAATTTTGACAAG
ACTGTCCCTGAATTTCCAACTCCTCTGGTTTCTAAAAGCCCAAACAGGACTGACCTGGAT
ATCCACATCAATGGACAAAGCATTGACAATTTTCAGATCTCTGAAACAGGACTGACAGAA
TAA
Restriction Sites Please inquire     
ACCN NM_001172417
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172417.1, NP_001165888.1
RefSeq Size 3376 bp
RefSeq ORF 843 bp
Locus ID 3769
Cytogenetics 2q37.1
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'This gene encodes a member of the inwardly rectifying potassium channel family of proteins. Members of this family form ion channel pores that allow potassium ions to pass into a cell. The encoded protein belongs to a subfamily of low signal channel conductance proteins that have a low dependence on potassium concentration. Mutations in this gene are associated with snowflake vitreoretinal degeneration. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]'
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and uses a downstream start codon, compared to variant 1. It encodes isoform 3, which has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.