AMACR (NM_001167597) Human Untagged Clone

CAT#: SC328464

AMACR (untagged)-Human alpha-methylacyl-CoA racemase (AMACR) nuclear gene encoding mitochondrial protein transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AMACR
• Synonyms: CBAS4; RACE; RM
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001167597, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCACTGCAGGGCATCTCGGTCGTGGAGCTGTCCGGCCTGGCCCCGGGCCCGTTCTGTGCTATGGTCC
  TGGCTGACTTCGGGGCGCGTGTGGTACGCGTGGACCGGCCCGGCTCCCGCTACGACGTGAGCCGCTTGGG
  CCGGGGCAAGCGCTCGCTAGTGCTGGACCTGAAGCAGCCGCGGGGAGCCGCCGTGCTGCGGCGTCTGTGC
  AAGCGGTCGGATGTGCTGCTGGAGCCCTTCCGCCGCGGTGTCATGGAGAAACTCCAGCTGGGCCCAGAGA
  TTCTGCAGCGGGAAAATCCAAGGCTTATTTATGCCAGGCTGAGTGGATTTGGCCAGTCAGGAAGCTTCTG
  CCGGTTAGCTGGCCACGATATCAACTATTTGGCTTTGTCAGGTGGAAGGAACAGCATATTTAAGTTCTTT
  TCTGTGGAAAACTCAGAAATTGAGTCTGTGGGAAGCACCTCGAGGACAGAACATGTTGGATGGTGGAGCA
  CCTTTCTATACGACTTACAGGACAGCAGATGGGGAATTCATGGCTGTTGGAGCAATAGAACCCCAGTTCT
  ACGAGCTGCTGATCAAAGGTCTGGGAGAACTGATCTTGCTGAAAATACAACAGGAAGCAGTATCGTGCCA
  GGCAAGGCAAACCCTCGTCAGTGTGAAGCAATGGCCATCGTTGCAGCCCAAGTCATGGGGTTTTGTGTGG
  CAGTAACCGTTGGAGGCGGCAATGGCCATTTTGAGTTGGATGTTTTCAAGCCAATGATGATTAAAAATTT
  ATGTTACACTCAGGCTGCTGGGGGATGCTTCAGTTTCCTTCACAGAAAACTAAATAGTGGGAATCCGGAC
  CAATAA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001167597
• ORF Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001167597.1, NP_001161069.1
• RefSeq Size: 1186
• RefSeq ORF: 846
• Locus ID: 23600
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Primary bile acid biosynthesis
• Gene Summary: This gene encodes a racemase. The encoded enzyme interconverts pristanoyl-CoA and C27-bile acylCoAs between their (R)- and (S)-stereoisomers. The conversion to the (S)-stereoisomers is necessary for degradation of these substrates by peroxisomal beta-oxidation. Encoded proteins from this locus localize to both mitochondria and peroxisomes. Mutations in this gene may be associated with adult-onset sensorimotor neuropathy, pigmentary retinopathy, and adrenomyeloneuropathy due to defects in bile acid synthesis. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the upstream neighboring C1QTNF3 (C1q and tumor necrosis factor related protein 3) gene. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (5) lacks an exon in the coding region and differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (5) has a distinct C-terminus and is shorter than isoform 1. This isoform is also referred to as AMACR IIB.