OSMR (NM_001168355) Human Untagged Clone

CAT#: SC328549

OSMR (untagged)-Human oncostatin M receptor (OSMR) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OSMR
• Synonyms: IL-31R-beta; IL-31RB; OSMRB; PLCA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001168355, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCTATTTGCAGTCTTTCAGACAACATTCTTCTTAACATTGCTGTCCTTGAGGACTTACCAGAGTG
  AAGTCTTGGCTGAACGTTTACCATTGACTCCTGTATCACTTAAAGTTTCCACCAATTCTACGCGTCAGAG
  TTTGCACTTACAATGGACTGTCCACAACCTTCCTTATCATCAGGAATTGAAAATGGTATTTCAGATCCAG
  ATCAGTAGGATTGAAACATCCAATGTCATCTGGGTGGGGAATTACAGCACCACTGTGAAGTGGAACCAGG
  TTCTGCATTGGAGCTGGGAATCTGAGCTCCCTTTGGAATGTGCCACACACTTTGTAAGAATAAAGAGTTT
  GGTGGACGATGCCAAGTTCCCTGAGCCAAATTTCTGGAGCAACTGGAGTTCCTGGGAGGAAGTCAGTGTA
  CAAGATTCTACTGGACAGGATATATTGTTCGTTTTCCCTAAAGATAAGCTGGTGGAAGAAGGCACCAATG
  TTACCATTTGTTACGTTTCTAGGAACATTCAAAATAATGTATCCTGTTATTTGGAAGGGAAACAGATTCA
  TGGAGAACAACTTGATCCACATGTAACTGCATTCAACTTGAATAGTGTGCCTTTCATTAGGAATAAAGGG
  ACAAATATCTATTGTGAGGCAAGTCAAGGAAATGTCAGTGAAGGCATGAAAGGCATCGTTCTTTTTGTCT
  CAAAAGTACTTGAGGAGCCCAAGGACTTTTCTTGTGAAACCGAGGACTTCAAGACTTTGCACTGTACTTG
  GGATCCTGGGACGGACACTGCCTTGGGGTGGTCTAAACAACCTTCCCAAAGCTACACTTTATTTGAATCA
  TTTTCTGGGGAAAAGAAACTTTGTACACACAAAAACTGGTGTAATTGGCAAATAACTCAAGACTCACAAG
  AAACCTATAACTTCACACTCATAGCTGAAAATTACTTAAGGAAGAGAAGTGTCAATATCCTTTTTAACCT
  GACTCATCGAGGTGAGACTAGAGTTGTCACAGCCCACCGTGGCCACTAA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001168355
• ORF Size: 1029 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001168355.2, NP_001161827.1
• RefSeq Size: 1825
• RefSeq ORF: 1029
• Locus ID: 9180
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]