PPAR delta (PPARD) (NM_001171820) Human Untagged Clone

CAT#: SC328550

PPARD (untagged)-Human peroxisome proliferator-activated receptor delta (PPARD) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPARD
• Synonyms: FAAR; NR1C2; NUC1; NUCI; NUCII; PPARB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171820, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCAGCCACAGGAGGAAGCCCCTGAGGTCCGGGAAGAGGAGGAGAAAGAGGAAGTGGCAGAGGCAG
  AAGGAGCCCCAGAGCTCAATGGGGGACCACAGCATGCACTTCCTTCCAGCAGCTACACAGCTATCCGTTT
  TGGTCGGATGCCGGAGGCTGAGAAGAGGAAGCTGGTGGCAGGGCTGACTGCAAACGAGGGGAGCCAGTAC
  AACCCACAGGTGGCCGACCTGAAGGCCTTCTCCAAGCACATCTACAATGCCTACCTGAAAAACTTCAACA
  TGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGA
  CATCGAGACATTGTGGCAGGCAGAGAAGGGGCTGGTGTGGAAGCAGTTGGTGAATGGCCTGCCTCCCTAC
  AAGGAGATCAGCGTGCACGTCTTCTACCGCTGCCAGTGCACCACAGTGGAGACCGTGCGGGAGCTCACTG
  AGTTCGCCAAGAGCATCCCCAGCTTCAGCAGCCTCTTCCTCAACGACCAGGTTACCCTTCTCAAGTATGG
  CGTGCACGAGGCCATCTTCGCCATGCTGGCCTCTATCGTCAACAAGGACGGGCTGCTGGTAGCCAACGGC
  AGTGGCTTTGTCACCCGTGAGTTCCTGCGCAGCCTCCGCAAACCCTTCAGTGATATCATTGAGCCTAAGT
  TTGAATTTGCTGTCAAGTTCAACGCCCTGGAACTTGATGACAGTGACCTGGCCCTATTCATTGCGGCCAT
  CATTCTGTGTGGAGACCGGCCAGGCCTCATGAACGTTCCACGGGTGGAGGCTATCCAGGACACCATCCTG
  CGTGCCCTCGAATTCCACCTGCAGGCCAACCACCCTGATGCCCAGTACCTCTTCCCCAAGCTGCTGCAGA
  AGATGGCTGACCTGCGGCAACTGGTCACCGAGCACGCCCAGATGATGCAGCGGATCAAGAAGACCGAAAC
  CGAGACCTCGCTGCACCCTCTGCTCCAGGAGATCTACAAGGACATGTACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001171820
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001171820.1, NP_001165291.1
• RefSeq Size: 3455 bp
• RefSeq ORF: 1032 bp
• Locus ID: 5467
• Cytogenetics: 6p21.31
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
• Protein Pathways: Acute myeloid leukemia, Pathways in cancer, PPAR signaling pathway, Wnt signaling pathway
• Gene Summary: 'This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. The encoded protein is thought to function as an integrator of transcriptional repression and nuclear receptor signaling. It may inhibit the ligand-induced transcriptional activity of peroxisome proliferator activated receptors alpha and gamma, though evidence for this effect is inconsistent. Expression of this gene in colorectal cancer cells may be variable but is typically relatively low. Knockout studies in mice suggested a role for this protein in myelination of the corpus callosum, lipid metabolism, differentiation, and epidermal cell proliferation. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Aug 2017]'
  Transcript Variant: This variant (5) lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (4) is shorter than isoform 1.