OGR1 (GPR68) (NM_001177676) Human Untagged Clone

CAT#: SC328588

GPR68 (untagged)-Human G protein-coupled receptor 68 (GPR68) transcript variant 1


  "NM_001177676" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GPR68"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GPR68
Synonyms AI2A6; GPR12A; OGR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001177676, the custom clone sequence may differ by one or more nucleotides


ATGGGGAACATCACTGCAGACAACTCCTCGATGAGCTGTACCATCGACCATACCATCCACCAGACGCTGG
CCCCGGTGGTCTATGTTACCGTGCTGGTGGTGGGCTTCCCGGCCAACTGCCTGTCCCTCTACTTCGGCTA
CCTGCAGATCAAGGCCCGGAACGAGCTGGGCGTGTACCTGTGCAACCTGACGGTGGCCGACCTCTTCTAC
ATCTGCTCGCTGCCCTTCTGGCTGCAGTACGTGCTGCAGCACGACAACTGGTCTCACGGCGACCTGTCCT
GCCAGGTGTGCGGCATCCTCCTGTACGAGAACATCTACATCAGCGTGGGCTTCCTCTGCTGCATCTCCGT
GGACCGCTACCTGGCTGTGGCCCATCCCTTCCGCTTCCACCAGTTCCGGACCCTGAAGGCGGCCGTCGGC
GTCAGCGTGGTCATCTGGGCCAAGGAGCTGCTGACCAGCATCTACTTCCTGATGCACGAGGAGGTCATCG
AGGACGAGAACCAGCACCGCGTGTGCTTTGAGCACTACCCCATCCAGGCATGGCAGCGCGCCATCAACTA
CTACCGCTTCCTGGTGGGCTTCCTCTTCCCCATCTGCCTGCTGCTGGCGTCCTACCAGGGCATCCTGCGC
GCCGTGCGCCGGAGCCACGGCACCCAGAAGAGCCGCAAGGACCAGATCCAGCGGCTGGTGCTCAGCACCG
TGGTCATCTTCCTGGCCTGCTTCCTGCCCTACCACGTGTTGCTGCTGGTGCGCAGCGTCTGGGAGGCCAG
CTGCGACTTCGCCAAGGGCGTTTTCAACGCCTACCACTTCTCCCTCCTGCTCACCAGCTTCAACTGCGTC
GCCGACCCCGTGCTCTACTGCTTCGTCAGCGAGACCACCCACCGGGACCTGGCCCGCCTCCGCGGGGCCT
GCCTGGCCTTCCTCACCTGCTCCAGGACCGGCCGGGCCAGGGAGGCCTACCCGCTGGGTGCCCCCGAGGC
CTCCGGGAAAAGCGGGGCCCAGGGTGAGGAGCCCGAGCTGTTGACCAAGCTCCACCCGGCCTTCCAGACC
CCTAACTCGCCAGGGTCGGGCGGGTTCCCCACGGGCAGGTTGGCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001177676
ORF Size 1098 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001177676.1, NP_001171147.1
RefSeq Size 2880
RefSeq ORF 1098
Locus ID 8111
Protein Families Druggable Genome, GPCR, Transmembrane
Gene Summary The protein encoded by this gene is a G protein-coupled receptor for sphingosylphosphorylcholine. The encoded protein is a proton-sensing receptor, inactive at pH 7.8 but active at pH 6.8. Mutations in this gene are a cause of amelogenesis imperfecta. [provided by RefSeq, Feb 2017]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. Variants 1-3 all encode the same protein. There is an upstream in-frame AUG (uAUG) present; however, translation is thought to begin from the annotated downstream AUG due to inhibition of the uAUG by a small overlapping open reading frame.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.