SAP102 (DLG3) (NM_001166278) Human Untagged Clone

CAT#: SC328589

DLG3 (untagged)-Human discs large homolog 3 (Drosophila) (DLG3) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DLG3
• Synonyms: MRX; MRX90; NEDLG; PPP1R82; SAP102; XLMR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166278, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGAACAGCAGCATGAGCTCTGGGTCTGGGTCCCTCCGAACAAGTGAAAAGAGGTCCTTGTATGTCA
  GGGCCCTGTTTGATTATGATCGGACTCGGGACAGCTGCCTGCCAAGCCAGGGGCTCAGCTTCTCTTATGG
  TGACATTCTGCATGTCATTAATGCCTCTGATGATGAGTGGTGGCAGGCAAGGCTGGTGACCCCACACGGA
  GAAAGTGAGCAGATCGGTGTGATCCCCAGTAAGAAGAGGGTGGAAAAGAAAGAAAGAGCTCGATTGAAAA
  CTGTGAAGTTCCATGCCAGGACGGGGATGATTGAGTCTAACAGGTCGATCAAAACGAAACGTAAAAAGAG
  TTTCCGCCTCTCTCGAAAGTTTCCATTTTACAAGAGCAAAGAAAACATGGCCCAGGAGAGCAGCATACAG
  GAACAGGGAGTGACATCCAACACCAGTGACAGCGAAAGCAGTTCCAAAGGACAAGAGGATGCTATTTTGT
  CATATGAGCCAGTGACACGGCAAGAAATTCACTATGCAAGGCCTGTGATCATCCTGGGCCCAATGAAGGA
  CCGAGTCAATGATGACCTGATCTCCGAATTTCCACATAAATTTGGATCCTGTGTGCCACATACTACCCGG
  CCTCGACGTGATAATGAGGTGGATGGACAAGACTACCACTTTGTGGTGTCCCGAGAACAAATGGAGAAAG
  ATATTCAGGACAACAAGTTCATCGAGGCGGGCCAATTTAATGATAACCTCTATGGGACCAGCATCCAGTC
  AGTGCGGGCAGTTGCAGAGAGGGGCAAGCACTGCATCTTAGATGTTTCCGGCAATGCTATCAAGAGACTG
  CAGCAAGCACAACTTTACCCCATTGCCATTTTCATCAAGCCCAAGTCCATTGAAGCCCTTATGGAAATGA
  ACCGAAGGCAGACATATGAACAAGCAAATAAGATCTATGACAAAGCCATGAAACTGGAGCAGGAATTTGG
  AGAGTACTTTACAGCCATTGTACAGGGTGACTCACTGGAAGAGATTTATAACAAAATCAAACAAATCATT
  GAGGACCAGTCTGGGCACTACATTTGGGTCCCATCCCCTGAAAAACTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166278
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001166278.1, NP_001159750.1
• RefSeq Size: 4544 bp
• RefSeq ORF: 1101 bp
• Locus ID: 1741
• Cytogenetics: Xq13.1
• Gene Summary: 'This gene encodes a member of the membrane-associated guanylate kinase protein family. The encoded protein may play a role in clustering of NMDA receptors at excitatory synapses. It may also negatively regulate cell proliferation through interaction with the C-terminal region of the adenomatosis polyposis coli tumor suppressor protein. Mutations in this gene have been associated with X-linked cognitive disability. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]'
  Transcript Variant: This variant (3) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. Translation initiates at a downstream AUG and results in an isoform (c) that is shorter than isoform a.