PEG10 (NM_001172438) Human Untagged Clone

CAT#: SC328643

PEG10 (untagged)-Human paternally expressed 10 (PEG10) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PEG10
• Synonyms: EDR; HB-1; Mar2; Mart2; MEF3L; RGAG3; RTL2; SIRH1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172438, the custom clone sequence may differ by one or more nucleotides
  ATGCGAAATAAGCGGGTTTTGAAAACAAAAAAAAGAAGGAGTGGAAGAGGGGGCCAGGAT
  CCAGGCCTCCATCCCCACAGAAGTGAAGCTACAGCTGGGAGGTCTCCTCCCACCCCAACC
  GTCACCCTGGGTCCCGACTGCCCACCTCCTCCTCCTCCCCCTCCCCCCAACAACAACAAC
  AACAACAACTCCAAGCACACCGGCCATAAGAGTGCGTGTGTCCCCAACATGACCGAACGA
  AGAAGGGACGAGCTCTCTGAAGAGATCAACAACTTAAGAGAGAAGGTCATGAAGCAGTCG
  GAGGAGAACAACAACCTGCAGAGCCAGGTGCAGAAGCTCACAGAGGAGAACACCACCCTT
  CGAGAGCAAGTGGAACCCACCCCTGAGGATGAGGATGATGACATCGAGCTCCGCGGTGCT
  GCAGCAGCTGCTGCCCCACCCCCTCCAATAGAGGAAGAGTGCCCAGAAGACCTCCCAGAG
  AAGTTCGATGGCAACCCAGACATGCTGGCTCCTTTCATGGCCCAGTGCCAGATCTTCATG
  GAAAAGAGCACCAGGGATTTCTCAGTTGATCGTGTCCGTGTCTGCTTCGTGACAAGCATG
  ATGACCGGCCGTGCTGCCCGTTGGGCCTCAGCAAAGCTGGAGCGCTCCCACTACCTGATG
  CACAACTACCCAGCTTTCATGATGGAAATGAAGCATGTCTTTGAAGACCCTCAGAGGCGA
  GAGGTTGCCAAACGCAAGATCAGACGCCTGCGCCAAGGCATGGGGTCTGTCATCGACTAC
  TCCAATGCTTTCCAGATGATTGCCCAGGACCTGGATTGGAACGAGCCTGCGCTGATTGAC
  CAGTACCACGAGGGCCTCAGCGACCACATTCAGGAGGAGCTCTCCCACCTCGAGGTCGCC
  AAGTCGCTGTCTGCTCTGATTGGGCAGTGCATTCACATTGAGAGAAGGCTGGCCAGGGCT
  GCTGCAGCTCGCAAGCCACGCTCGCCACCCCGGGCGCTGGTGTTGCCTCACATTGCAAGC
  CACCACCAGGTAGATCCAACCGAGCCGGTGGGAGGTGCCCGCATGCGCCTGACGCAGGAA
  GAAAAAGAAAGACGCAGAAAGCTGAACCTGTGCCTCTACTGTGGAACAGGAGGTCACTAC
  GCTGACAATTGTCCTGCCAAGGCCTCAAAGTCTTCGCCGGCGGGAAACTCCCCGGCCCCG
  CTGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001172438
• ORF Size: 1206 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001172438.1, NP_001165909.1
• RefSeq Size: 6602
• RefSeq ORF: 1206
• Locus ID: 23089
• Gene Summary: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation and apoptosis. Overexpression of this gene has been associated with several malignancies, such as hepatocellular carcinoma and B-cell lymphocytic leukemia. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. Additional isoforms resulting from alternatively spliced transcript variants, and use of upstream non-AUG (CUG) start codon have been reported for this gene. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) has two overlapping open reading frames (RF1 and RF2). It uses an alternate donor splice site at the 5' terminal exon and initiates translation from an alternate, upstream AUG compared to variant 1. This isoform (4) produced from RF1 in the absence of -1 translational frameshifting has a longer and distinct N-terminus, but a shorter C-terminus compared to isoform 1.