CGGBP1 (NM_001195308) Human Untagged Clone

CAT#: SC329452

CGGBP1 (untagged) - Homo sapiens CGG triplet repeat binding protein 1 (CGGBP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CGGBP1
• Synonyms: CGGBP; p20-CGGBP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001195308, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCGATTTGTAGTAACAGCACCACCTGCTCGAAACCGTTCTAAGACTGCTTTGTATGTGACTCCCC
  TGGATCGAGTCACTGAGTTTGGAGGTGAGCTGCATGAAGATGGAGGAAAACTCTTCTGCACTTCTTGCAA
  TGTGGTTCTGAATCATGTTCGCAAGTCTGCCATTAGTGACCACCTCAAGTCAAAGACTCATACCAAGAGG
  AAGGCAGAATTTGAAGAGCAGAATGTGAGAAAGAAGCAGAGGCCCCTAACTGCATCTCTTCAGTGCAACA
  GTACTGCGCAAACAGAGAAAGTCAGTGTTATCCAGGACTTTGTGAAAATGTGCCTGGAAGCCAACATCCC
  ACTTGAGAAGGCTGATCACCCAGCAGTCCGTGCTTTCCTATCTCGCCATGTGAAGAATGGAGGCTCCATA
  CCTAAGTCAGACCAGCTACGGAGGGCATATCTTCCTGATGGATATGAGAATGAGAATCAACTCCTCAACT
  CACAAGATTGTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001195308
• ORF Size: 504 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001195308.1, NP_001182237.1
• RefSeq Size: 4589
• RefSeq ORF: 504
• Locus ID: 8545
• Gene Summary: This gene encodes a CGG repeat-binding protein that primarily localizes to the nucleus. CGG trinucleotide repeats are implicated in many disorders as they often act as transcription- and translation-regulatory elements, can produce hairpin structures which cause DNA replication errors, and form regions prone to chromosomal breakage. CGG repeats are also targets for CpG methylation. In addition to its ability to bind CGG repeats and regulate transcription, this gene is believed to play a role in DNA damage repair and telomere protection. In vitro studies indicate this protein does not bind to methylated CpG sequences. [provided by RefSeq, Jul 2017]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.